SCOC (NM_001153446) Human Untagged Clone

SKU
SC327365
SCOC (untagged)-Human short coiled-coil protein (SCOC) transcript variant 6
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SCOC
Synonyms HRIHFB2072; SCOCO; UNC-69
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327365 representing NM_001153446.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACGGGTCCAGGAAAGAGGAGGAGGAAGACAGCACATTCACCAACATTTCTCTTGCAGATGACATA
GACCATTCCTCAAGAATTTTGTATCCAAGGCCCAAAAGTTTGTTACCCAAGATGATGAATGCTGACATG
GATGCAGTTGATGCTGAAAATCAAGTGGAACTGGAGGAAAAAACAAGACTTATTAATCAAGTGTTGGAA
CTCCAACACACACTTGAAGATCTCTCTGCAAGAGTAGATGCAGTTAAGGAAGAAAATCTGAAGCTAAAA
TCAGAAAACCAAGTTCTTGGACAATATATAGAAAATCTCATGTCAGCTTCTAGTGTTTTTCAAACAACT
GACACAAAAAGCAAAAGAAAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001153446
Insert Size 369 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001153446.1
RefSeq Size 1876 bp
RefSeq ORF 369 bp
Locus ID 60592
UniProt ID Q9UIL1
Cytogenetics 4q31.1
MW 13.9 kDa
Summary This gene encodes a short coiled-coiled domain-containing protein that localizes to the Golgi apparatus. The encoded protein interacts with ADP-ribosylation factor-like proteins. Pseudogenes of this gene are found on chromosomes 1 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Transcript Variant: This variant (6) differs in the 5' UTR and 5' coding region, compared to variant 1, resulting in an isoform (4) with a distinct and shorter N-terminus, compared to isoform 1. Variants 4, 5 and 6 encode the same isoform.
Write Your Own Review
You're reviewing:SCOC (NM_001153446) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228730 SCOC (Myc-DDK-tagged)-Human short coiled-coil protein (SCOC), transcript variant 6 10 ug
$470.00
RC228730L3 Lenti ORF clone of Human short coiled-coil protein (SCOC), transcript variant 6, Myc-DDK-tagged 10 ug
$770.00
RC228730L4 Lenti ORF clone of Human short coiled-coil protein (SCOC), transcript variant 6, mGFP tagged 10 ug
$770.00
RG228730 SCOC (tGFP-tagged) - Human short coiled-coil protein (SCOC), transcript variant 6 10 ug
$670.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.