SKA3 (NM_001166017) Human Untagged Clone

SKU
SC326949
SKA3 (untagged)-Human spindle and kinetochore associated complex subunit 3 (SKA3) transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SKA3
Synonyms C13orf3; RAMA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC326949 representing NM_001166017.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACCCTATCCGGAGCTTCTGCGGGAAGCTGCGGTCTCTGGCCAGCACGCTGGACTGCGAGACGGCC
CGGCTGCAGCGAGCGCTGGACGGAGAGGAAAGCGACTTTGAAGATTATCCAATGAGAATTTTATATGAC
CTTCATTCAGAAGTTCAGACTCTAAAGGATGATGTTAATATTCTTCTTGATAAAGCAAGATTGGAAAAT
CAAGAAGGCATTGATTTCATAAAGGCAACAAAAGTACTAATGGAAAAAAATTCAATGGATATTATGAAA
ATAAGAGAGTATTTCCAGAAGTATGGATATAGTCCACGTGTCAAGAAAAATTCAGTACACGAGCAAGAA
GCCATTAACTCTGACCCAGAGTTGTCTAATTGTGAAAATTTTCAGAAGACTGATGTGAAAGATGATCTG
TCTGATCCTCCTGTTGCAAGCAGTTGTATTTCTGAGAAGTCTCCACGTAGTCCACAACTTTCAGATTTT
GGACTTGAGCGGTACATCGTATCCCAAGTTCTACCAAACCCTCCACAGGCAGTGAACAACTATAAGGAA
GAGCCCGTAATTGTAACCCCACCTACCAAACAATCACTAGTAAAAGTACTAAAAACTCCAAAATGTGCA
CTAAAAATGGATGATTTTGAGTGTGTAACTCCTAAATTAGAACACTTTGGTATCTCTGAATATACTATG
TGTTTAAATGAAGATTACACAATGGGACTTAAAAATGCGAGGAATAATAAAAGTGAGGAGGCCATAGAT
ACAGAATCCAGGCTCAATGATAATGTTTTTGCCACTCCCAGCCCCATCATCCAGCAGTTGGAAAAAAGT
GATGCCGAATATACCAACTCTCCTTTGGTACCTACATTCTGTACTCCTGGTTTGAAAATTCCATCTACA
AAGAACAGCATAGCTTTGGTATCCACAAATTACCCATTATCAAAAACAAATAGTTCATCAAATGATTTG
GAAGTTGAAGATCGTACTTCGTTGGTTTTAAATTCAGACACATGCTTTGAGAATTTAACAGATCCCTCT
TCACCTACGATTTCTTCTTATGAGAATCTGCTCAGAACACCTACACCTCCGGAAGTAACTAAAATTCCA
GAAGATATTCTCCAGAAATTCCAGTGGATCTATCCAACACAGAAACTGAACAAAATGAGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001166017
Insert Size 1167 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001166017.1
RefSeq Size 2808 bp
RefSeq ORF 1167 bp
Locus ID 221150
UniProt ID Q8IX90
Cytogenetics 13q12.11
MW 44 kDa
Summary This gene encodes a component of the spindle and kinetochore-associated protein complex that regulates microtubule attachment to the kinetochores during mitosis. The encoded protein localizes to the outer kinetechore and may be required for normal chromosome segregation and cell division. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and alternate stop codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:SKA3 (NM_001166017) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228314 SKA3 (Myc-DDK-tagged)-Human spindle and kinetochore associated complex subunit 3 (SKA3), transcript variant 2 10 ug
$457.00
RC228314L3 Lenti ORF clone of Human spindle and kinetochore associated complex subunit 3 (SKA3), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC228314L4 Lenti ORF clone of Human spindle and kinetochore associated complex subunit 3 (SKA3), transcript variant 2, mGFP tagged 10 ug
$757.00
RG228314 SKA3 (tGFP-tagged) - Human spindle and kinetochore associated complex subunit 3 (SKA3), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.