TLCD1 (NM_001160407) Human Untagged Clone

SKU
SC326766
TLCD1 (untagged)-Human TLC domain containing 1 (TLCD1) transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TLCD1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC326766 representing NM_001160407.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGTTACTCAGCAGTTCCCAAGTGCCCACCTCGCGGGCGCGGGAGGGACAGTGTATGGCAGACTCCT
GACATGTTAGTGGAGATTGAGACGGCGTGGTCACTTTCTGGCTATTTGCTCGTTTGCTTCTCTGCGGGG
TATTTCATCCACGATACGGTGGACATCGTGGCTAGCGGACAGACGCGAGCCTCTTGGGAATACCTTGTC
CATCACGTCATGGCCATGGGTGCCTTCTTCTCCGGCATCTTTTGGAGCAGCTTTGTCGGTGGGGGTGTC
TTAACACTACTGGTGGAAGTCAGCAACATCTTCCTCACCATTCGCATGATGATGAAAATCAGTAATGCC
CAGGATCATCTCCTCTACCGGGTTAACAAGTATGTGAACCTGGTCATGTACTTTCTCTTCCGCCTGGCC
CCTCAGGCCTACCTCACCCATTTCTTCTTGCGTTATGTGAACCAGAGGACCCTGGGCACCTTCCTGCTG
GGTATCCTGCTCATGCTGGACGTGATGATCATAATCTACTTTTCCCGCCTCCTCCGCTCTGACTTCTGC
CCTGAGCATGTCCCCAAGAAGCAACACAAAGACAAGTTCTTGACTGAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001160407
Insert Size 603 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001160407.1
RefSeq Size 904 bp
RefSeq ORF 603 bp
Locus ID 116238
UniProt ID Q96CP7
Cytogenetics 17q11.2
Protein Families Transmembrane
MW 23.1 kDa
Summary Regulates the composition and fluidity of the plasma membrane (PubMed:30509349). Inhibits the incorporation of membrane-fluidizing phospholipids containing omega-3 long-chain polyunsaturated fatty acids (LCPUFA) and thereby promotes membrane rigidity (PubMed:30509349). Does not appear to have any effect on LCPUFA synthesis (PubMed:30509349).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1.
Write Your Own Review
You're reviewing:TLCD1 (NM_001160407) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228131 TLCD1 (Myc-DDK-tagged)-Human TLC domain containing 1 (TLCD1), transcript variant 2 10 ug
$300.00
RC228131L3 Lenti ORF clone of Human TLC domain containing 1 (TLCD1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC228131L4 Lenti ORF clone of Human TLC domain containing 1 (TLCD1), transcript variant 2, mGFP tagged 10 ug
$600.00
RG228131 TLCD1 (tGFP-tagged) - Human TLC domain containing 1 (TLCD1), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.