NFYC (NM_001142589) Human Untagged Clone
SKU
SC325732
NFYC (untagged)-Human nuclear transcription factor Y, gamma (NFYC), transcript variant 4
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | NFYC |
Synonyms | CBF-C; CBFC; H1TF2A; HAP5; HSM; NF-YC |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC325732 representing NM_001142589.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCCACAGAAGGAGGATTTGGTGGTACTAGCAGCAGTGATGCCCAGCAAAGCCTACAGTCGTTCTGG CCTCGGGTCATGGAAGAAATCCGGAATTTAACAGTGAAAGACTTCCGAGTGCAGGAACTCCCACTGGCT CGTATTAAGAAGATTATGAAACTGGATGAAGATGTGAAGAGAAATGATATCGCCATGGCAATTACAAAA TTTGATCAGTTTGATTTTCTCATCGATATTGTTCCAAGAGATGAACTGAAACCTCCAAAGCGTCAGGAG GAGGTGCGCCAGTCTGTAACTCCTGCCGAGCCAGTCCAGTACTATTTCACGCTGGCTCAGCAACCCACC GCTGTCCAAGTCCAGGGCCAGCAGCAAGGCCAGCAGACCACCAGCTCCACGACCACCATCCAGCCTGGG CAGATCATCATCGCACAGCCTCAGCAGGGCCAGACCACACCTGTGACAATGCAGGTTGGAGAAGGTCAG CAGGTGCAGATTGTCCAGGCTCAGCCACAGGGTCAAGCCCAACAGGCCCAGAGTGGCACTGGACAGACC ATGCAGGTGATGCAGCAGATCATCACTAACACAGGAGAGATCCAGCAGATCCCGGTGCAGCTGAATGCC GGCCAGCTGCAGTATATCCGCTTAGCCCAGCCTGTATCAGGCACTCAAGTTGTGCAGGGACAGATCCAG ACACTTGCCACCAATGCTCAACAGATTACACAGACAGAGGTCCAGCAAGGACAGCAGCAGTTCAGCCAG TTCACAGATGGACAGCAGCTCTACCAGATCCAGCAAGTCACCATGCCTGCGGGCCAGGACCTCGCCCAG CCCATGTTCATCCAGTCAGCCAACCAGCCCTCCGACGGGCAGGCCCCCCAGGTGACCGGCGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001142589 |
Insert Size | 894 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001142589.1 |
RefSeq Size | 1991 bp |
RefSeq ORF | 894 bp |
Locus ID | 4802 |
UniProt ID | Q13952 |
Cytogenetics | 1p34.2 |
Protein Families | Transcription Factors |
Protein Pathways | Antigen processing and presentation |
MW | 32.8 kDa |
Summary | This gene encodes one subunit of a trimeric complex forming a highly conserved transcription factor that binds with high specificity to CCAAT motifs in the promoters of a variety of genes. The encoded protein, subunit C, forms a tight dimer with the B subunit, a prerequisite for subunit A association. The resulting trimer binds to DNA with high specificity and affinity. Subunits B and C each contain a histone-like motif. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008] Transcript Variant: This variant (4) lacks two alternate in-frame exons in the 5' and 3' coding regions, compared to variant 1. The resulting isoform (4) has the same N- and C- termini but lacks two internal segments, compared to isoform 1. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC226680 | NFYC (Myc-DDK-tagged)-Human nuclear transcription factor Y, gamma (NFYC), transcript variant 4 | 10 ug |
$300.00
|
|
RC226680L3 | Lenti ORF clone of Human nuclear transcription factor Y, gamma (NFYC), transcript variant 4, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC226680L4 | Lenti ORF clone of Human nuclear transcription factor Y, gamma (NFYC), transcript variant 4, mGFP tagged | 10 ug |
$600.00
|
|
RG226680 | NFYC (tGFP-tagged) - Human nuclear transcription factor Y, gamma (NFYC), transcript variant 4 | 10 ug |
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.