CDK6 (NM_001145306) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | CDK6 |
Synonyms | MCPH12; PLSTIRE |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC324946 representing NM_001145306.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGAAGGACGGCCTGTGCCGCGCTGACCAGCAGTACGAATGCGTGGCGGAGATCGGGGAGGGCGCC TATGGGAAGGTGTTCAAGGCCCGCGACTTGAAGAACGGAGGCCGTTTCGTGGCGTTGAAGCGCGTGCGG GTGCAGACCGGCGAGGAGGGCATGCCGCTCTCCACCATCCGCGAGGTGGCGGTGCTGAGGCACCTGGAG ACCTTCGAGCACCCCAACGTGGTCAGGTTGTTTGATGTGTGCACAGTGTCACGAACAGACAGAGAAACC AAACTAACTTTAGTGTTTGAACATGTCGATCAAGACTTGACCACTTACTTGGATAAAGTTCCAGAGCCT GGAGTGCCCACTGAAACCATAAAGGATATGATGTTTCAGCTTCTCCGAGGTCTGGACTTTCTTCATTCA CACCGAGTAGTGCATCGCGATCTAAAACCACAGAACATTCTGGTGACCAGCAGCGGACAAATAAAACTC GCTGACTTCGGCCTTGCCCGCATCTATAGTTTCCAGATGGCTCTAACCTCAGTGGTCGTCACGCTGTGG TACAGAGCACCCGAAGTCTTGCTCCAGTCCAGCTACGCCACCCCCGTGGATCTCTGGAGTGTTGGCTGC ATATTTGCAGAAATGTTTCGTAGAAAGCCTCTTTTTCGTGGAAGTTCAGATGTTGATCAACTAGGAAAA ATCTTGGACGTGATTGGACTCCCAGGAGAAGAAGACTGGCCTAGAGATGTTGCCCTTCCCAGGCAGGCT TTTCATTCAAAATCTGCCCAACCAATTGAGAAGTTTGTAACAGATATCGATGAACTAGGCAAAGACCTA CTTCTGAAGTGTTTGACATTTAACCCAGCCAAAAGAATATCTGCCTACAGTGCCCTGTCTCACCCATAC TTCCAGGACCTGGAAAGGTGCAAAGAAAACCTGGATTCCCACCTGCCGCCCAGCCAGAACACCTCGGAG CTGAATACAGCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145306 |
Insert Size | 981 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001145306.1 |
RefSeq Size | 11733 bp |
RefSeq ORF | 981 bp |
Locus ID | 1021 |
UniProt ID | Q00534 |
Cytogenetics | 7q21.2 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Cell cycle, Chronic myeloid leukemia, Glioma, Melanoma, Non-small cell lung cancer, p53 signaling pathway, Pancreatic cancer, Pathways in cancer, Small cell lung cancer |
MW | 36.9 kDa |
Summary | The protein encoded by this gene is a member of the CMGC family of serine/threonine protein kinases. This kinase is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression and G1/S transition. The activity of this kinase first appears in mid-G1 phase, which is controlled by the regulatory subunits including D-type cyclins and members of INK4 family of CDK inhibitors. This kinase, as well as CDK4, has been shown to phosphorylate, and thus regulate the activity of, tumor suppressor protein Rb. Altered expression of this gene has been observed in multiple human cancers. A mutation in this gene resulting in reduced cell proliferation, and impaired cell motility and polarity, and has been identified in patients with primary microcephaly. [provided by RefSeq, Aug 2017] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC227978 | CDK6 (Myc-DDK-tagged)-Human cyclin-dependent kinase 6 (CDK6), transcript variant 2 | 10 ug |
$300.00
|
|
RC227978L3 | Lenti ORF clone of Human cyclin-dependent kinase 6 (CDK6), transcript variant 2, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC227978L4 | Lenti ORF clone of Human cyclin-dependent kinase 6 (CDK6), transcript variant 2, mGFP tagged | 10 ug |
$600.00
|
|
RG227978 | CDK6 (tGFP-tagged) - Human cyclin-dependent kinase 6 (CDK6), transcript variant 2 | 10 ug |
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.