DOHH (NM_001145165) Human Untagged Clone

SKU
SC324917
DOHH (untagged)-Human deoxyhypusine hydroxylase/monooxygenase (DOHH), transcript variant 1
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DOHH
Synonyms hDOHH; HLRC1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC324917 representing NM_001145165.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGACGGAGCAGGAGGTGGATGCCATCGGGCAGACGCTGGTGGACCCCAAGCAGCCCCTGCAGGCC
CGCTTCCGGGCGCTGTTCACGCTGCGTGGGCTCGGCGGCCCAGGCGCCATTGCATGGATCAGCCAGGCC
TTCGATGACGATTCCGCCCTGCTCAAGCACGAGCTGGCCTACTGCCTGGGCCAGATGCAGGATGCCCGC
GCCATCCCCATGCTGGTGGACGTGCTGCAAGACACCCGTCAGGAGCCCATGGTGCGCCATGAGGCAGGG
GAGGCCCTGGGGGCCATCGGGGACCCGGAAGTTCTGGAGATCCTGAAGCAGTATTCCTCGGACCCCGTC
ATCGAGGTGGCCGAGACCTGCCAGCTGGCCGTGCGCAGGCTGGAGTGGCTGCAGCAGCACGGCGGGGAG
CCGGCGGCGGGACCCTACCTCTCCGTGGACCCTGCCCCGCCGGCTGAGGAGCGTGACGTGGGGCGCCTG
CGGGAGGCGCTGCTGGATGAGTCCCGGCCGCTCTTCGAGCGATACCGCGCCATGTTCGCCCTGCGCAAC
GCGGGAGGCGAGGAGGCCGCCCTGGCGCTGGCCGAGGGTCTGCACTGTGGGAGCGCCCTCTTCCGCCAC
GAGGTCGGCTACGTCCTGGGACAGCTGCAGCACGAGGCGGCGGTGCCCCAGCTGGCGGCCGCCCTGGCC
CGATGCACCGAGAACCCCATGGTGCGGCACGAGTGCGCGGAGGCCCTGGGCGCCATTGCCCGGCCCGCC
TGCCTGGCCGCGCTGCAGGCTCACGCGGACGACCCAGAGCGCGTGGTGCGTGAGAGCTGCGAGGTGGCT
CTGGACATGTATGAGCACGAGACCGGGCGGGCCTTCCAGTACGCGGACGGCCTGGAGCAGCTGCGCGGG
GCCCCCTCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001145165
Insert Size 909 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001145165.1
RefSeq Size 2050 bp
RefSeq ORF 909 bp
Locus ID 83475
UniProt ID Q9BU89
Cytogenetics 19p13.3
MW 32.9 kDa
Summary This gene encodes a metalloenzyme that catalyzes the last step in the conversion of lysine to the unique amino acid hypusine in eukaryotic initiation factor 5A. The encoded protein hydroxylates deoxyhypusine to form hypusine in the mature eukaryotic initiation factor 5A protein. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.
Write Your Own Review
You're reviewing:DOHH (NM_001145165) Human Untagged Clone
Your Rating
SKU Description Size Price
RC226938 DOHH (Myc-DDK-tagged)-Human deoxyhypusine hydroxylase/monooxygenase (DOHH), transcript variant 1 10 ug
$300.00
RC226938L1 Lenti ORF clone of Human deoxyhypusine hydroxylase/monooxygenase (DOHH), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC226938L2 Lenti ORF clone of Human deoxyhypusine hydroxylase/monooxygenase (DOHH), transcript variant 1, mGFP tagged 10 ug
$600.00
RC226938L3 Lenti ORF clone of Human deoxyhypusine hydroxylase/monooxygenase (DOHH), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC226938L4 Lenti ORF clone of Human deoxyhypusine hydroxylase/monooxygenase (DOHH), transcript variant 1, mGFP tagged 10 ug
$600.00
RG226938 DOHH (tGFP-tagged) - Human deoxyhypusine hydroxylase/monooxygenase (DOHH), transcript variant 1 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.