C1QB (NM_000491) Human Untagged Clone

SKU
SC323799
C1QB (untagged)-Human complement component 1, q subcomponent, B chain (C1QB)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C1QB
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000491.3 GGCTCCTGGTCCCACTGCTGCTCAGCCCAGTGGCCTCACAGGACACCAGCTTCCCAGGAG
GCGTCTGACACAGTATGATGATGAAGATCCCATGGGGCAGCATCCCAGTACTGATGTTGC
TCCTGCTCCTGGGCCTAATCGATATCTCCCAGGCCCAGCTCAGCTGCACCGGGCCCCCAG
CCATCCCTGGCATCCCGGGTATCCCTGGGACACCTGGCCCCGATGGCCAACCTGGGACCC
CAGGGATAAAAGGAGAGAAAGGGCTTCCAGGGCTGGCTGGAGACCATGGTGAGTTCGGAG
AGAAGGGAGACCCAGGGATTCCTGGGAATCCAGGAAAAGTCGGCCCCAAGGGCCCCATGG
GCCCTAAAGGTGGCCCAGGGGCCCCTGGAGCCCCAGGCCCCAAAGGTGAATCGGGAGACT
ACAAGGCCACCCAGAAAATCGCCTTCTCTGCCACAAGAACCATCAACGTCCCCCTGCGCC
GGGACCAGACCATCCGCTTCGACCACGTGATCACCAACATGAACAACAATTATGAGCCCC
GCAGTGGCAAGTTCACCTGCAAGGTGCCCGGTCTCTACTACTTCACCTACCACGCCAGCT
CTCGAGGGAACCTGTGCGTGAACCTCATGCGTGGCCGGGAGCGTGCACAGAAGGTGGTCA
CCTTCTGTGACTATGCCTACAACACCTTCCAGGTCACCACCGGTGGCATGGTCCTCAAGC
TGGAGCAGGGGGAGAACGTCTTCCTGCAGGCCACCGACAAGAACTCACTACTGGGCATGG
AGGGTGCCAACAGCATCTTTTCCGGGTTCCTGCTCTTTCCAGATATGGAGGCCTGACCTG
TGGGCTGCTTCACATCCACCCCGGCTCCCCCTGCCAGCAACGCTCACTCTACCCCCAACA
CCACCCCTTGCCCAGCCAATGCACACAGTAGGGCTTGGTGAATGCTGCTGAGTGAATGAG
TAAATAAACTCTTCAAGGCCAAGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites ECoRI-NOT
ACCN NM_000491
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000491.3, NP_000482.3
RefSeq Size 1044 bp
RefSeq ORF 762 bp
Locus ID 713
UniProt ID P02746
Cytogenetics 1p36.12
Domains C1Q, Collagen
Protein Families Secreted Protein
Protein Pathways Complement and coagulation cascades, Prion diseases, Systemic lupus erythematosus
Summary This gene encodes the B-chain polypeptide of serum complement subcomponent C1q, which associates with C1r and C1s to yield the first component of the serum complement system. C1q is composed of 18 polypeptide chains which include 6 A-chains, 6 B-chains, and 6 C-chains. Each chain contains an N-terminal collagen-like region and a C-terminal C1q globular domain. C1q deficiency is associated with lupus erythematosus and glomerulonephritis. [provided by RefSeq, Dec 2016]
Write Your Own Review
You're reviewing:C1QB (NM_000491) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203821 C1QB (Myc-DDK-tagged)-Human complement component 1, q subcomponent, B chain (C1QB) 10 ug
$300.00
RC203821L3 Lenti ORF clone of Human complement component 1, q subcomponent, B chain (C1QB), Myc-DDK-tagged 10 ug
$600.00
RC203821L4 Lenti ORF clone of Human complement component 1, q subcomponent, B chain (C1QB), mGFP tagged 10 ug
$600.00
RG203821 C1QB (tGFP-tagged) - Human complement component 1, q subcomponent, B chain (C1QB) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC119857 C1QB (untagged)-Human complement component 1, q subcomponent, B chain (C1QB) 10 ug
$457.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.