LCE6A (NM_001128600) Human Untagged Clone

SKU
SC322797
LCE6A (untagged)-Human late cornified envelope 6A (LCE6A)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LCE6A
Synonyms C1orf44
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC322797 representing NM_001128600.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCACAGCAGAAGCAGCAATCTTGGAAGCCTCCAAATGTTCCCAAATGCTCCCCTCCCCAAAGATCA
AACCCCTGCCTAGCTCCCTACTCGACTCCTTGTGGTGCTCCCCATTCAGAAGGTTGTCATTCCAGTTCC
CAAAGGCCTGAGGTTCAGAAGCCTAGGAGGGCTCGTCAAAAGCTGCGCTGCCTAAGTAGGGGCACAACC
TACCACTGCAAAGAGGAAGAGTGTGAAGGCGACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001128600
Insert Size 243 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001128600.1
RefSeq Size 654 bp
RefSeq ORF 243 bp
Locus ID 448835
UniProt ID A0A183
Cytogenetics 1q21.3
MW 9 kDa
Summary Precursors of the cornified envelope of the stratum corneum.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:LCE6A (NM_001128600) Human Untagged Clone
Your Rating
SKU Description Size Price
RC224998 LCE6A (Myc-DDK-tagged)-Human late cornified envelope 6A (LCE6A) 10 ug
$150.00
RC224998L3 Lenti ORF clone of Human late cornified envelope 6A (LCE6A), Myc-DDK-tagged 10 ug
$450.00
RC224998L4 Lenti ORF clone of Human late cornified envelope 6A (LCE6A), mGFP tagged 10 ug
$450.00
RG224998 LCE6A (tGFP-tagged) - Human late cornified envelope 6A (LCE6A) 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.