FKBP7 (NM_181342) Human Untagged Clone

SKU
SC322353
FKBP7 (untagged)-Human FK506 binding protein 7 (FKBP7), transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FKBP7
Synonyms FKBP23; PPIase
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322353 CACGGGGCGCGAGTGACACGCGGGAGGGAGAGCAGTGTTCTGCTGGAGCCGATGCCAAAA
ACCATGCATTTCTTATTCAGATTCATTGTTTTCTTTTATCTGTGGGGCCTTTTTACTGCT
CAGAGACAAAAGAAAGAGGAGAGCACCGAAGAAGTGAAAATAGAAGTTTTGCATCGTCCA
GAAAACTGCTCTAAGACAAGCAAGAAGGGAGACCTACTAAATGCCCATTATGACGGCTAC
CTGGCTAAAGACGGCTCGAAATTCTACTGCAGCCGGACACAAAATGAAGGCCACCCCAAA
TGGTTTGTTCTTGGTGTTGGGCAAGTCATAAAAGGCCTAGACATTGCTATGACAGATATG
TGCCCTGGAGAAAAGCGAAAAGTAGTTATACCCCCTTCATTTGCATACGGAAAGGAAGGC
TATGCAGAAGGCAAGATTCCACCGGATGCTACATTGATTTTTGAGATTGAACTTTATGCT
GTGACCAAAGGACCACGGAGCATTGAGACATTTAAACAAATAGACATGGACAATGACAGG
CAGCTCTCTAAAGCCGAGATAAACCTCTACTTGCAAAGGGAATTTGAAAAAGATGAGAAG
CCACGTGACAAGTCATATCAGGATGCAGTTTTAGAAGATATTTTTAAGAAGAATGACCAT
GATGGTGATGGCTTCATTTCTCCCAAGGAATACAATGTATACCAACACGATGAACTATAG
CATATTTGTATTTCTACTTTTTTTTTTTAGCTATTTACTGTACTTTATGTATAAAACAAA
GTCACTTTTCTCCAAGTTGTATTTGCTATTTTTCCCCTATGAGAAGATATTTTGATCTCC
CCAATACATTGATTTTGGTATAATAAATGTGAGGCTGTTTTGCAAACTTAAAAAAAAAAA
AAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_181342
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_181342.1, NP_851939.1
RefSeq Size 1241 bp
RefSeq ORF 669 bp
Locus ID 51661
UniProt ID Q9Y680
Cytogenetics 2q31.2
Protein Families Druggable Genome, Transmembrane
Summary The protein encoded by this gene belongs to the FKBP-type peptidyl-prolyl cis/trans isomerase (PPIase) family. Members of this family exhibit PPIase activity and function as molecular chaperones. A similar protein in mouse is located in the endoplasmic reticulum and binds calcium. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).
Write Your Own Review
You're reviewing:FKBP7 (NM_181342) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202176 FKBP7 (Myc-DDK-tagged)-Human FK506 binding protein 7 (FKBP7), transcript variant 1 10 ug
$300.00
RC202176L1 Lenti ORF clone of Human FK506 binding protein 7 (FKBP7), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC202176L2 Lenti ORF clone of Human FK506 binding protein 7 (FKBP7), transcript variant 1, mGFP tagged 10 ug
$600.00
RC202176L3 Lenti ORF clone of Human FK506 binding protein 7 (FKBP7), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC202176L4 Lenti ORF clone of Human FK506 binding protein 7 (FKBP7), transcript variant 1, mGFP tagged 10 ug
$600.00
RG202176 FKBP7 (tGFP-tagged) - Human FK506 binding protein 7 (FKBP7), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.