C1QC (NM_172369) Human Untagged Clone

SKU
SC322245
C1QC (untagged)-Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 2
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C1QC
Synonyms C1Q-C; C1QG
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322245 GGGGAAGCAGATCTGAGGACATCTCTGTGCCAGGCCAGAAACCGCCCACCTGCAGTTCCT
TCTCCGGGATGGACGTGGGGCCCAGCTCCCTGCCCCACCTTGGGCTGAAGCTGCTGCTGC
TCCTGCTGCTGCTGCCCCTCAGGGGCCAAGCCAACACAGGCTGCTACGGGATCCCAGGGA
TGCCCGGCCTGCCTGGGGCACCAGGGAAGGATGGGTACGACGGACTGCCGGGGCCCAAGG
GGGAGCCAGGAATCCCAGCCATTCCCGGGATCCGAGGACCCAAAGGGCAGAAGGGAGAAC
CCGGCTTACCCGGCCATCCTGGGAAAAATGGCCCCATGGGACCCCCTGGGATGCCAGGGG
TGCCCGGCCCCATGGGCATCCCTGGAGAGCCAGGTGAGGAGGGCAGATACAAGCAGAAAT
TCCAGTCAGTGTTCACGGTCACTCGGCAGACCCACCAGCCCCCTGCACCCAACAGCCTGA
TCAGATTCAACGCGGTCCTCACCAACCCGCAGGGAGATTATGACACGAGCACTGGCAAGT
TCACCTGCAAAGTCCCCGGCCTCTACTACTTTGTCTACCACGCGTCGCATACAGCCAACC
TGTGCGTGCTGCTGTACCGCAGCGGCGTCAAAGTGGTCACCTTCTGTGGCCACACGTCCA
AAACCAATCAGGTCAACTCGGGCGGTGTGCTGCTGAGGTTGCAGGTGGGCGAGGAGGTGT
GGCTGGCTGTCAATGACTACTACGACATGGTGGGCATCCAGGGCTCTGACAGCGTCTTCT
CCGGCTTCCTGCTCTTCCCCGACTAGGGCGGGCAGATGCGCTCGAGACCCACGGGCCTTC
CACCTCCCTCAGCTTCCTGCATGGACCCACCTTACTGGCCAGTCTGCATCCTTGCCTAGA
CCATTCTCCCCTCCAGGGAGCCCACCCTGACCCACCCCCACTGCACCCCCTCCCCATGGG
TTCTCTCCTTCCTCTGAACTTCTTTAGGAGTCACTGCTTGTGTGGTTCCTGGGACACTTA
ACCAATGCCTTCTGGTACTGCCATTCTTTTTTTTTTTTTTTCAAGTATTGGAAGGGGTGG
GGAGATATATAAATAAATCATGAAATCAATACATAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAA
Restriction Sites Please inquire
ACCN NM_172369
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_172369.2, NP_758957.2
RefSeq Size 1171 bp
RefSeq ORF 738 bp
Locus ID 714
UniProt ID P02747
Cytogenetics 1p36.12
Protein Families Secreted Protein
Protein Pathways Complement and coagulation cascades, Prion diseases, Systemic lupus erythematosus
Summary This gene encodes the C-chain polypeptide of serum complement subcomponent C1q, which associates with C1r and C1s to yield the first component of the serum complement system. C1q is composed of 18 polypeptide chains which include 6 A-chains, 6 B-chains, and 6 C-chains. Each chain contains an N-terminal collagen-like region and a C-terminal C1q globular domain. C1q deficiency is associated with lupus erythematosus and glomerulonephritis. [provided by RefSeq, Dec 2016]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1-3 encode the same isoform (1).
Write Your Own Review
You're reviewing:C1QC (NM_172369) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203832 C1QC (Myc-DDK-tagged)-Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 2 10 ug
$300.00
RC203832L3 Lenti ORF clone of Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC203832L4 Lenti ORF clone of Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 2, mGFP tagged 10 ug
$600.00
RG203832 C1QC (tGFP-tagged) - Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC124311 C1QC (untagged)-Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 2 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.