Proteasome 20S alpha 5 (PSMA5) (NM_002790) Human Untagged Clone

SKU
SC322079
PSMA5 (untagged)-Human proteasome (prosome, macropain) subunit, alpha type, 5 (PSMA5), transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Proteasome 20S alpha 5
Synonyms PSC5; ZETA
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322079 GTGGGTGAGTTGGCTGCCGGTGAGTTGGGTGCCGGTGGAGTCGTGTTGGTCCTCAGAATC
CCCGCGTAGCCGCTGCCTCCTCCTACCCTCGCCATGTTTCTTACCCGGTCTGAGTACGAC
AGGGGCGTGAATACTTTTTCTCCCGAAGGAAGATTATTTCAAGTGGAATATGCCATTGAG
GCTATCAAGCTTGGTTCTACAGCCATTGGGATCCAGACATCAGAGGGTGTGTGCCTAGCT
GTGGAGAAGAGAATTACTTCCCCACTGATGGAGCCCAGCAGCATTGAGAAAATTGTAGAG
ATTGATGCTCACATAGGTTGTGCCATGAGTGGGCTAATTGCTGATGCTAAGACTTTAATT
GATAAAGCCAGAGTGGAGACACAGAACCACTGGTTCACCTACAATGAGACAATGACAGTG
GAGAGTGTGACCCAAGCTGTGTCCAATCTGGCTTTGCAGTTTGGAGAAGAAGATGCAGAT
CCAGGTGCCATGTCTCGTCCCTTTGGAGTAGCATTATTATTTGGAGGAGTTGATGAGAAA
GGACCCCAGCTGTTTCATATGGACCCATCTGGGACCTTTGTACAGTGTGATGCTCGAGCA
ATTGGCTCTGCTTCAGAGGGTGCCCAGAGCTCCTTGCAAGAAGTTTACCACAAGTCTATG
ACTTTGAAAGAAGCCATCAAGTCTTCACTCATCATCCTCAAACAAGTAATGGAGGAGAAG
CTGAATGCAACAAACATTGAGCTAGCCACAGTGCAGCCTGGCCAGAATTTCCACATGTTC
ACAAAGGAAGAACTTGAAGAGGTTATCAAGGACATTTAAGGAATCCTGATCCTCAGAACT
TCTCTGGGACAATTTCAGTTCTAATAATGTCCTTAAATTTTATTTCCAGCTCCTGTTCCT
TGGAAAATCTCCATTGTATGTGCATTTTTTAAATGATGTCTGTACATAAAGGCAGTTCTG
AAATAAAGAAAATTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_002790
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002790.2, NP_002781.2
RefSeq Size 1023 bp
RefSeq ORF 726 bp
Locus ID 5686
UniProt ID P28066
Cytogenetics 1p13.3
Domains proteasome
Protein Families Druggable Genome, Protease
Protein Pathways Proteasome
Summary The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (1) is the predominant transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Proteasome 20S alpha 5 (PSMA5) (NM_002790) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210717 PSMA5 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) subunit, alpha type, 5 (PSMA5), transcript variant 1 10 ug
$300.00
RC210717L3 Lenti ORF clone of Human proteasome (prosome, macropain) subunit, alpha type, 5 (PSMA5), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC210717L4 Lenti ORF clone of Human proteasome (prosome, macropain) subunit, alpha type, 5 (PSMA5), transcript variant 1, mGFP tagged 10 ug
$600.00
RG210717 PSMA5 (tGFP-tagged) - Human proteasome (prosome, macropain) subunit, alpha type, 5 (PSMA5), transcript variant 1 10 ug
$500.00
SC118413 PSMA5 (untagged)-Human proteasome (prosome, macropain) subunit, alpha type, 5 (PSMA5), transcript variant 1 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.