DHFR (NM_000791) Human Untagged Clone

CAT#: SC321334

DHFR (untagged)-Human dihydrofolate reductase (DHFR)

USD 402


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name DHFR (NM_000791) Human Untagged Clone
Symbol DHFR
Synonyms DHFRP1; DYR
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000791.3 CTTGACCGCGCGTTCTGCTGTAACGAGCGGGCTCGGAGGTCCTCCCGCTGCTGTCATGGT
TGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCAAGAACGGGGA
CCTGCCCTGGCCACCGCTCAGGAATGAATTCAGATATTTCCAGAGAATGACCACAACCTC
TTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTAAGAAGACCTGGTTCTCCATTCC
TGAGAAGAATCGACCTTTAAAGGGTAGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGA
ACCTCCACAAGGAGCTCATTTTCTTTCCAGAAGTCTAGATGATGCCTTAAAACTTACTGA
ACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTA
TAAGGAAGCCATGAATCACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGA
CTTTGAAAGTGACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGA
ATACCCAGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAATATGAAGGTGTTTTCTAGTTTAAGTTGTTCCCCCTCCCTCT
GAAAAAAGTATGTATTTTTACATTAGAAAAGGTTTTTTGTTGACTTTAGATCTATAATTA
TTTCTAAGCAACTAGTTTTTATTCCCCACTACTCTTGTCTCTATCAGATACCATTTATGA
GACATTCTTGCTATAACTAAGTGCTTCTCCAAGACCCCAACTGAGTCCCCAGCACCTGCT
ACAGTGAGCTGCCATTCCACACCCATCACATGTGGCACTCTTGCCAGTCCTTGACATTGT
CGGGCTTTTCACATGTTGGTAATATTTATTAAAGATGAAGATCCACATACCCTTCAACTG
AGCAGTTTCACTAGTGGAAATACCAAAAGCTTCCTACGTGTATATCCAGAGGTTTGTAGA
TAAATGTTGCCACCTTGTTTGTAACAGTGAAAAATTGAAAACAACCTGGAAGTCCAGTGA
TGGGAAAATGAGTATGTTTCTGTCTTAGATTGGGGAACCCAAAGCAGATTGCAAGACTGA
AATTTCAGTGAAAGCAGTGTATTTGCTAGGTCATACCAGAAATCATCAATTGAGGTACGG
AGAAACTGAACTGAGAAGGTAAGAAAAGCAATTTAAAGTCAGCGAGCAGGTTCTCATTGA
TAACAAGCTCCATACTGCTGAGATACAGGGAAATGGAGGGGGGAAAGCTGGAGTATTGAT
CCCGCCCCCCTCCTTGGTTGTCAGCTCCCTGTCCTGTGTGTGGGCGGAACATAGTCCAGC
TGCTCTATAGCAAGTCTCAGGTGTTTGCAGTAAGAAGCTGCTGGCATGCACGGGAACAGT
GAATGCCAAACACTTAAAGCAATTCGATGTTTAAGTATGTAAGTTCTTTTTTTTTTAGAC
AGCGTTTCGCTCTTGTTGCCCAGGCTGGCATGCAGTGGTGTGACCTCGGCTTACTGCAAC
CTCCGCCTTCCCAGATTCAAGCGATTCTCCTGCCTCAGGCTCCCAAGTAGCTAGGACCAG
GTGCGCGCCACCACGCCCGGCTAATTTTTGTATTTTGTATTTTTAGTAGAGATGGGGTTT
CACCATGTTGGTCAGGCTGGTCTCGAACTCGTGACCGCAAGCGATTCACCCACCTCAGCC
TCCCAAAGTGCTGGGATTACCGGCTTGAGCCACCACACCCGGCACATCTTCATTCTTTTT
ATGTAGTAAAAAGTATAAGGCCACACATGGTTTATTTGAAGTATTTTATAATTTAAAAAA
ATACAGAAGCAGGAAAACCAATTATAAGTTCAAGTGAGGGATGATGGTTGCTTGAACCAA
AGGGTTGCATGTAGTAAGAAATTGTGATTTAAGATATATTTTAAAGTTATAAGTAGCAGG
ATATTCTGATGGAGTTTGACTTTGGTTTTGGGCCCAGGGAGTTTCAGATGCCTTTGAGAA
ATGAATGAAGTAGAGAGAAAATAAAAGAAAAACCAGCCAGGCACAGTGGCTCACGCCTGT
AATCCCAGCGCTTTGGGAGGCTAAGGCAGGCAGATCACTTGAGACCAGCTTGGGCAACAT
GGCAAAGCCCCATCTCTACAAAAAACACAAAAATTAGCTGGGCATTGTGGCGCACACCTG
TATTCCCATCTAGTCAGGAAGCTGAGATGGAAGAATTAATTGAGCCCACGAGTTCAAGGC
TGCAGTGAGTCGTGATTGTGCCACTGCACTCCAGCCGGGGTGACAGAAGAGACCTTGTCT
CGAAAAGGAATCTGAAAACAATGGAACCATGCCTTCATAATTCTAGAAAGTTATTTTCAA
CTGATAAATCTATATTCACCCAAATAATCAAGGGTGAAGGTAAAATAATACATTTTTAGA
CAAGCAAAGACTCAGGGGTTACCTCCATGTGCCCTTTTTAGGGAAGCTGTTGGAGAAAAT
ACTCCAGCAAAATGAAGGAGTACACAAACCAGAGAATGACATGAATCCAGCAAATAGGAT
CCAACACAGGCAATATTCCAGCTATGGAGCTAGCTTTAAAAAGGAACAGTAAAAATATTA
ATCGGTTAGCTGGGTGGAATGGCCCATGCCTGTAGTCCCAGCTACTCAGGAGGCTCAGCA
GCAGGACGACTTGAGCCCAAGAGTTCCAGACCAGCCTGGCCACCTTAGTGAGATCCCTTC
TCTTAAAAATAATAACTTATTGCCAGATTTGGGGCATTTGGAAAGAAGTTCATTGAAGAT
AAAGCAAAAGTAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000791.3 unedited
CGCCATTGTATACGACTCCTATAGGGCGGCGCGGGAATTCGTCGACTGGATCCGGTACCG
AGGAGATCTGCCGCCGCGATCGCGGCGCGCCAGATCTCAAGCTTAACTAGTTAGCGGACC
GACGCGTTAAGCGGCCGCGAATTCAGATCCACAAGTTTGTACAAAAAAGCAGGCTTGTAA
AACGACGGCCAGTAACTATAACGGTCCTAAGGTAGCGAGGCCTGGGTGGCGAATTCGGCA
CGAGGCTTGACCGCGCGTTCTGCTGTAACGAGCGGGCTCGGAGGTCCTCCCGCTGCTGTC
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGTAACATGGGCATCGGCAAGAA
CGGGGACCTGCCCTGGCCACCGCTCAGGAATGAATTCAGATATTTCCAGAGAATGACCAC
AACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTAAGAAGACCTGGTTCTC
CATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAATTTAGTTCTCAGCAGAGAACT
CAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAGTCTAGATGATGCCTTAAAACTT
ACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTTGGTGGCAGTTCT
GTTTATAAAGGAAGCCATGAATCACCCAGGCCATCTTAAACTATTTGTGACAAGATCATG
CAAGACTTTGAAAGTGACACGTTTTTTCCAGAATTGATTTGGAGAAATAATAAACTTCTG
CCAGAATACCCAGTGTTTCCTCTTCTGATTGTCCAGGAGAGAAGCATTAAGGTACAATTT
GAAGTATATGAGAAGAATGAATAATATGAGGTGGTTTTCTAGTTTAGTTGTTCCCCTTCC
TCTGAAAAAAAGTATGTATTTTACATTAAAAAAAGGTTTTTTGGTGGACTTAGATCCA
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_000791
ORF Size 564 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000791.3, NP_000782
RefSeq Size 3932
RefSeq ORF 564
Locus ID 1719
Cytogenetics 5q14.1
Domains DiHfolate_red
Protein Families Stem cell - Pluripotency, Druggable Genome
Protein Pathways One carbon pool by folate, Folate biosynthesis, Metabolic pathways
Gene Summary Dihydrofolate reductase converts dihydrofolate into tetrahydrofolate, a methyl group shuttle required for the de novo synthesis of purines, thymidylic acid, and certain amino acids. While the functional dihydrofolate reductase gene has been mapped to chromosome 5, multiple intronless processed pseudogenes or dihydrofolate reductase-like genes have been identified on separate chromosomes. Dihydrofolate reductase deficiency has been linked to megaloblastic anemia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014].
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.