C2orf28 (ATRAID) (NM_016085) Human Untagged Clone

SKU
SC320990
ATRAID (untagged)-Human chromosome 2 open reading frame 28 (C2orf28), transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C2orf28
Synonyms APR--3; APR-3; APR3; C2orf28; HSPC013; p18; PRO240
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_016085.3 GTCTTACGACCCTGGTGCCCTGGGCTGCCGCCCTGCTCCTCGCTCTGGGCGTGGAAAGGG
CTCTGGCGCTACCCGAGGTACAGAAGCAAGTTTGAGGTCGGGCTGAAGCAGGGTCACTGG
CCAGCCGTGCGTCGCGCTCGCCAGCGGCTCCCCCTTCTCCTCGGCGGGCCTGCGGTTCTG
ATTTCGTCCCTGACGCTTCCCGACCCTGCCCAGCCAGATATGCACCCAATGTCCAGGGAG
CGTGCAAAATTTGTCAAAAGTGGCCTTTTATTGTAAAACGACACGAGAGCTAATGCTGCA
TGCCCGTTGCTGCCTGAATCAGAAGGGCACCATCTTGGGGCTGGATCTCCAGAACTGTTC
TCTGGAGGACCCTGGTCCAAACTTTCATCAGGCACATACCACTGTCATCATAGACCTGCA
AGCAAACCCCCTCAAAGGTGACTTGGCCAACACCTTCCGTGGCTTTACTCAGCTCCAGAC
TCTGATACTGCCACAACATGTCAACTGTCCTGGAGGAATTAATGCCTGGAATACTATCAC
CTCTTATATAGACAACCAAATCTGTCAAGGGCAAAAGAACCTTTGCAATAACACTGGGGA
CCCAGAAATGTGTCCTGAGAATGGATCTTGTGTACCTGATGGTCCAGGTCTTTTGCAGTG
TGTTTGTGCTGATGGTTTCCATGGATACAAGTGTATGCGCCAGGGCTCGTTCTCACTGCT
TATGTTCTTCGGGATTCTGGGAGCCACCACTCTATCCGTCTCCATTCTGCTTTGGGCGAC
CCAGCGCCGAAAAGCCAAGACTTCATGAACTACATAGGTCTTACCATTGACCTAAGATCA
ATCTGAACTATCTTAGCCCAGTCAGGGAGCTCTGCTTCCTAGAAAGGCATCTTTCGCCAG
TGGATTCGCCTCAAGGTTGAGGCCGCCATTGGAAGATGAAAAATTGCACTCCCTTGGTGT
AGACAAATACCAGTTCCCATTGGTGTTGTTGCCTATAATAAACACTTTTTCTTTTTTTTC
CTCTCTTTCTTTTTAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_016085
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016085.3, NP_057169.2
RefSeq Size 1417 bp
RefSeq ORF 516 bp
Locus ID 51374
UniProt ID Q6UW56
Cytogenetics 2p23.3
Protein Families Druggable Genome, Transmembrane
Summary This gene is thought to be involved in apoptosis, and may also be involved in hematopoietic development and differentiation. The use of alternative splice sites and promotors result in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2009]
Transcript Variant: This variant (1) starts from an alternate promoter and uses an alternate splice site in the 5' UTR, compared to variant 2. These differences cause translation initiation from a downstream in-frame AUG and an isoform (a) with a shorter N-terminus compared to isoform b.
Write Your Own Review
You're reviewing:C2orf28 (ATRAID) (NM_016085) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203440 ATRAID (Myc-DDK-tagged)-Human chromosome 2 open reading frame 28 (C2orf28), transcript variant 1 10 ug
$300.00
RC203440L3 Lenti ORF clone of Human chromosome 2 open reading frame 28 (C2orf28), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC203440L4 Lenti ORF clone of Human chromosome 2 open reading frame 28 (C2orf28), transcript variant 1, mGFP tagged 10 ug
$600.00
RG203440 ATRAID (tGFP-tagged) - Human chromosome 2 open reading frame 28 (C2orf28), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC114444 ATRAID (untagged)-Human chromosome 2 open reading frame 28 (C2orf28), transcript variant 1 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.