HLA-DPB1 (NM_002121) Human Untagged Clone

SKU
SC320914
HLA (untagged)-Human major histocompatibility complex, class II, DP beta 1 (HLA-DPB1)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HLA-DPB1
Synonyms DPB1; HLA-DP; HLA-DP1B; HLA-DPB
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002121.4 GCTCTTTTCATTTTGCCATCCTTTTCCAGCTCCATGATGGTTCTGCAGGTTTCTGCGGCC
CCCCGGACAGTGGCTCTGACGGCGTTACTGATGGTGCTGCTCACATCTGTGGTCCAGGGC
AGGGCCACTCCAGAGAATTACGTGCACCAGTTACGGCAGGAATGCTACGCGTTTAATGGG
ACACAGCGCTTCCTGGAGAGATACATCTACAACCGGGAGGAGTTCGTGCGCTTCGACAGC
GACGTGGGGGAGTTCCGGGCGGTGACGGAGCTGGGGCGGCCTGATGAGGACTACTGGAAC
AGCCAGAAGGACATCCTGGAGGAGGAGCGGGCAGTGCCGGACAGGATGTGCAGACACAAC
TACGAGCTGGACGAGGCCGTGACCCTGCAGCGCCGAGTCCAGCCTAGGGTGAATGTTTCC
CCCTCCAAGAAGGGGCCCTTGCAGCACCACAACCTGCTTGTCTGCCACGTGACGGATTTC
TACCCAGGCAGCATTCAAGTCCGATGGTTCCTGAATGGACAGGAGGAAACAGCTGGGGTC
GTGTCCACCAACCTGATCCGTAATGGAGACTGGACCTTCCAGATCCTGGTGATGCTGGAA
ATGACCCCCCAGCAGGGAGATGTCTACACCTGCCAAGTGGAGCACACCAGCCTGGATAGT
CCTGTCACCGTGGAGTGGAAGGCACAGTCTGATTCTGCCCGGAGTAAGACATTGACGGGA
GCTGGGGGCTTCGTGCTGGGGCTCATCATCTGTGGAGTGGGCATCTTCATGCACAGGAGG
AGCAAGAAAGTTCAACGAGGATCTGCATAAACAGGGTTCCTGAGCTCACTGAAAAGACTA
TTGTGCCTTAGGAAAAGCATTTGCTGTGTTTCGTTAGCATCTGGCTCCAGGACAGACCTT
CAACTTCCAAATTGGATACTGCTGCCAAGAAGTTGCTCTGAAGTCAGTTTCTATCATTCT
GCTCTTTGATTCAAAGCACTGTTTCTCTCACTGGGCCTCCAACCATGTTCCCTTCTTCTT
AGCACCACAAATAATCAAAACCCAACATGAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_002121
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002121.4, NP_002112.3
RefSeq Size 1501 bp
RefSeq ORF 777 bp
Locus ID 3115
UniProt ID P04440
Cytogenetics 6p21.32
Domains ig, IGc1, MHC_II_beta
Protein Families Transmembrane
Protein Pathways Allograft rejection, Antigen processing and presentation, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Graft-versus-host disease, Systemic lupus erythematosus, Type I diabetes mellitus, Viral myocarditis
Summary HLA-DPB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DPA) and a beta chain (DPB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DP molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to 4 different molecules. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:HLA-DPB1 (NM_002121) Human Untagged Clone
Your Rating
SKU Description Size Price
RC204966 HLA (Myc-DDK-tagged)-Human major histocompatibility complex, class II, DP beta 1 (HLA-DPB1) 10 ug
$300.00
RC204966L1 Lenti ORF clone of Human major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), Myc-DDK-tagged 10 ug
$600.00
RC204966L2 Lenti ORF clone of Human major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mGFP tagged 10 ug
$600.00
RC204966L3 Lenti ORF clone of Human major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), Myc-DDK-tagged 10 ug
$600.00
RC204966L4 Lenti ORF clone of Human major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mGFP tagged 10 ug
$600.00
RG204966 HLA (tGFP-tagged) - Human major histocompatibility complex, class II, DP beta 1 (HLA-DPB1) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC118846 HLA (untagged)-Human major histocompatibility complex, class II, DP beta 1 (HLA-DPB1) 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.