OGG1 (NM_002542) Human Untagged Clone

SKU
SC320638
OGG1 (untagged)-Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol OGG1
Synonyms HMMH; HOGG1; MUTM; OGH1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002542.4 CACAGCTGTGCGCGCCCACAGGCTCTGGGGGCGGGAGAAGATAAGTCGCAAGGAGGGGGC
GGGACCTACACCTCAGGAAAGCCGGAGAATTGGGGCACGAAGCGGGGCTTTGATGACCCG
CAAAGGGCGAGGCATGCAGGAGGTGGAGGAATTAAGTGAAACAGGGAAGGTTGTTAAACA
GCACCGTGTGGGCGAGGCCTTAAGGGTCGTGGTCCTTGTCTGGGCGGGGTCTTTGGGCGT
CGACGAGGCCTGGTTCTGGGTAGGCGGGGCTACTACGGGGCGGTGCCTGCTGTGGAAATG
CCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCTGCC
CTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCTTCT
GGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCGGAT
CAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGAGAC
AAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTCCAG
CTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTCCAA
GAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGCCTT
TTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAGCGG
CTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGCTTC
CCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGCCTG
GGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGCGGG
CTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTCTGC
ATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGACAAG
CCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGCTGG
CACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGAAAC
TTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGGTGCTGTTCAGTGCC
GACCTGCGCCAATGCCGCCATGCTCAGGAGCCACCAGCAAAGCGCAGAAAGGGTTCCAAA
GGGCCGGAAGGCTAGATGGGGCACCCTGGACAAAGAAATTCCCCAAGCACCTTCCCCTCC
ATTCCCCACTTCTCTCTCCCCATCCCCACCCAGTCTCATGTTGGGGAGGGGCCTCCCTGT
GACTACCTCAAAGGCCAGGCACCCCCAAATCAAGCAGTCAGTTTGCACAACAAGATGGGG
TGGGGGATATTGAGGGAGACAGCGCTAAGGATGGTTTTATCTTCCCTTTATTACAAGAAG
GAACAATAAAATAGAAACATTTGTATGGAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_002542
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002542.4, NP_002533.1
RefSeq Size 2557 bp
RefSeq ORF 1038 bp
Locus ID 4968
UniProt ID O15527
Cytogenetics 3p25.3
Domains ENDO3c, HHH
Protein Families Druggable Genome
Protein Pathways Base excision repair
Summary This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined. [provided by RefSeq, Aug 2008]
Transcript Variant: Transcript variant 1a represents the predominant form of this gene.
Write Your Own Review
You're reviewing:OGG1 (NM_002542) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200522 OGG1 (Myc-DDK-tagged)-Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a 10 ug
$686.00
RC200522L1 Lenti ORF clone of Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a, Myc-DDK-tagged 10 ug
$986.00
RC200522L2 Lenti ORF clone of Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a, mGFP tagged 10 ug
$986.00
RC200522L3 Lenti ORF clone of Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a, Myc-DDK-tagged 10 ug
$986.00
RC200522L4 Lenti ORF clone of Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a, mGFP tagged 10 ug
$986.00
RG200522 OGG1 (tGFP-tagged) - Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a 10 ug
$886.00
SC309025 OGG1 (untagged)-Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a 10 ug
$686.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.