CCDC107 (NM_174923) Human Untagged Clone

SKU
SC319581
CCDC107 (untagged)-Human coiled-coil domain containing 107 (CCDC107), transcript variant A
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CCDC107
Synonyms PSEC0222
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_174923.1 GGGCGGCCGGCCAATGCCGGACCGCTTCGGCACCGCCCGCCCGATCCCTCCACCCGTGGG
CCGGCAATGGCGGGCGCAGTTTCGCTCTTGGGTGTGGTGGGGCTGCTGCTTGTGTCTGCG
CTGTCCGGGGTCCTAGGAGACCGCGCCAATCCCGACCTCCGGGCACACCCAGGGAACGCA
GCCCACCCCGGCTCTGGAGCCACGGAACCCCGGCGGCGACCACCGCTCAAGGATCAACGC
GAGCGGACCCGGGCCGGGTCGCTGCCTCTGGGGGCGCTGTACACCGCGGCCGTCGCGGCT
TTTGTGCTGTACAAGTGTTTGCAGGGGAAAGATGAAACTGCGGTTCTCCACGAGGAGGCA
AGCAAGCAGCAGCCACTGCAGTCAGAGCAACAGCTGGCCCAGTTGACACAACAGCTGGCC
CAGACAGAGCAGCACCTGAACAACCTGATGGCCCAGCTGGACCCCCTTTTTGAGCGTGTG
ACTACTCTGGCTGGAGCCCAGCAGGAGCTTCTGAACATGAAGCTATGGACCATCCACGAG
CTGCTGCAAGATAGCAAGCCGGACAAGGATATGGAGGCTTCAGAACCAGGTGAAGGCTCG
GGAGGCGAGTCTGCTGGAGGTGGAGACAAAGTCTCTGAAACTGGAACATTCCTGATCTCT
CCCCACACAGAGGCCAGCAGACCTCTTCCTGAGGACTTCTGTTTAAAGGAGGACGAGGAG
GAGGTTGGTGACAGTCAGGCCTGGGAGGAGCCCACAAACTGGAGCACAGAGACATGGAAC
CTAGCTACTTCCTGGGAGGTGGGGCGGGGACTACGGAGAAGGTGCAGCCAGGCTGTGGCA
AAGGGCCCCAGTCACAGCCTTGGCTGGGAAGGAGGGACGACAGCTGAAGGTCGACTAAAA
CAAAGTCTGTTTTCATGAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_174923
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_174923.1, NP_777583.1
RefSeq Size 936 bp
RefSeq ORF 852 bp
Locus ID 203260
UniProt ID Q8WV48
Cytogenetics 9p13.3
Protein Families Transmembrane
Summary This gene encodes a membrane protein which contains a coiled-coil domain in the central region. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (A) represents the longest transcript and encodes the longest isoform (A).
Write Your Own Review
You're reviewing:CCDC107 (NM_174923) Human Untagged Clone
Your Rating
SKU Description Size Price
RC205865 CCDC107 (Myc-DDK-tagged)-Human coiled-coil domain containing 107 (CCDC107), transcript variant A 10 ug
$300.00
RC205865L3 Lenti ORF clone of Human coiled-coil domain containing 107 (CCDC107), transcript variant A, Myc-DDK-tagged 10 ug
$600.00
RC205865L4 Lenti ORF clone of Human coiled-coil domain containing 107 (CCDC107), transcript variant A, mGFP tagged 10 ug
$600.00
RG205865 CCDC107 (tGFP-tagged) - Human coiled-coil domain containing 107 (CCDC107), transcript variant A 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.