Asialoglycoprotein Receptor 1 (ASGR1) (NM_001671) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Asialoglycoprotein Receptor 1 |
Synonyms | ASGPR; ASGPR1; CLEC4H1; HL-1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_001671.2
CATCTGCACAGCACTGAAGAACCTGGGAATCAGACCCTGAGACCCTGAGCAATCCCAGGT
CCAGCGCCAGCCCTATCATGACCAAGGAGTATCAAGACCTTCAGCATCTGGACAATGAGG AGAGTGACCACCATCAGCTCAGAAAAGGGCCACCTCCTCCCCAGCCCCTCCTGCAGCGTC TCTGCTCCGGACCTCGCCTCCTCCTGCTCTCCCTGGGCCTCAGCCTCCTGCTGCTTGTGG TTGTCTGTGTGATCGGATCCCAAAACTCCCAGCTGCAGGAGGAGCTGCGGGGCCTGAGAG AGACGTTCAGCAACTTCACAGCGAGCACGGAGGCCCAGGTCAAGGGCTTGAGCACCCAGG GAGGCAATGTGGGAAGAAAGATGAAGTCGCTAGAGTCCCAGCTGGAGAAACAGCAGAAGG ACCTGAGTGAAGATCACTCCAGCCTGCTGCTCCACGTGAAGCAGTTCGTGTCTGACCTGC GGAGCCTGAGCTGTCAGATGGCGGCGCTCCAGGGCAATGGCTCAGAAAGGACCTGCTGCC CGGTCAACTGGGTGGAGCACGAGCGCAGCTGCTACTGGTTCTCTCGCTCCGGGAAGGCCT GGGCTGACGCCGACAACTACTGCCGGCTGGAGGACGCGCACCTGGTGGTGGTCACGTCCT GGGAGGAGCAGAAATTTGTCCAGCACCACATAGGCCCTGTGAACACCTGGATGGGCCTCC ACGACCAAAACGGGCCCTGGAAGTGGGTGGACGGGACGGACTACGAGACGGGCTTCAAGA ACTGGAGGCCGGAGCAGCCGGACGACTGGTACGGCCACGGGCTCGGAGGAGGCGAGGACT GTGCCCACTTCACCGACGACGGCCGCTGGAACGACGACGTCTGCCAGAGGCCCTACCGCT GGGTCTGCGAGACAGAGCTGGACAAGGCCAGCCAGGAGCCACCTCTCCTTTAATTTATTT CTTCAATGCCTCGACCTGCCGCAGGGGTCCGGGATTGGGAATCCGCCCATCTGGGGGCCT CTTCTGCTTTCTCGGGAATTTTCATCTAGGATTTTAAGGGAAGGGGAAGGATAGGGTGAT GTTCCGAAGGTGAGGAGCTTGAAACCCGTGGCGCTTTCTGCAGTTTGCAGGTTATCATTG TGAACTTTTTTTTTTTAAGAGTAAAAAGAAATATACCTAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001671 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001671.2, NP_001662.1 |
RefSeq Size | 1285 bp |
RefSeq ORF | 876 bp |
Locus ID | 432 |
UniProt ID | P07306 |
Cytogenetics | 17p13.1 |
Domains | CLECT, lectin_N |
Protein Families | Druggable Genome, Transmembrane |
Summary | This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the more abundant major subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (1), also known as H1a, represents the longer transcript and encodes the longer isoform (a). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC205686 | ASGR1 (Myc-DDK-tagged)-Human asialoglycoprotein receptor 1 (ASGR1), transcript variant 1 | 10 ug |
$300.00
|
|
RC205686L1 | Lenti ORF clone of Human asialoglycoprotein receptor 1 (ASGR1), transcript variant 1, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC205686L2 | Lenti ORF clone of Human asialoglycoprotein receptor 1 (ASGR1), transcript variant 1, mGFP tagged | 10 ug |
$600.00
|
|
RC205686L3 | Lenti ORF clone of Human asialoglycoprotein receptor 1 (ASGR1), transcript variant 1, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC205686L4 | Lenti ORF clone of Human asialoglycoprotein receptor 1 (ASGR1), transcript variant 1, mGFP tagged | 10 ug |
$600.00
|
|
RG205686 | ASGR1 (tGFP-tagged) - Human asialoglycoprotein receptor 1 (ASGR1), transcript variant 1 | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.