APE1 (APEX1) (NM_080648) Human Untagged Clone
SKU
SC319461
APEX1 (untagged)-Human APEX nuclease (multifunctional DNA repair enzyme) 1 (APEX1), transcript variant 2
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | APE1 |
Synonyms | APE; APE1; APEN; APEX; APX; HAP1; REF1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_080648.1
CCGGTGCAGATACGGGGTTGCTCTTTTGCTCATAAGAGGGGCTTCGCTGGCAGTCTGAAC
GGCAACGCGGTAAAAATATTGCTTCGGTGGGTGACGCGGTACAGCTGCCCAAGGGCGTTC GTAACGGGAATGCCGAAGCGTGGGAAAAAGGGAGCGGTGGCGGAAGACGGGGATGAGCTC AGGACAGAGCCAGAGGCCAAGAAGAGTAAGACGGCCGCAAAGAAAAATGACAAAGAGGCA GCAGGAGAGGGCCCAGCCCTGTATGAGGACCCCCCAGATCAGAAAACCTCACCCAGTGGC AAACCTGCCACACTCAAGATCTGCTCTTGGAATGTGGATGGGCTTCGAGCCTGGATTAAG AAGAAAGGATTAGATTGGGTAAAGGAAGAAGCCCCAGATATACTGTGCCTTCAAGAGACC AAATGTTCAGAGAACAAACTACCAGCTGAACTTCAGGAGCTGCCTGGACTCTCTCATCAA TACTGGTCAGCTCCTTCGGACAAGGAAGGGTACAGTGGCGTGGGCCTGCTTTCCCGCCAG TGCCCACTCAAAGTTTCTTACGGCATAGGCGATGAGGAGCATGATCAGGAAGGCCGGGTG ATTGTGGCTGAATTTGACTCGTTTGTGCTGGTAACAGCATATGTACCTAATGCAGGCCGA GGTCTGGTACGACTGGAGTACCGGCAGCGCTGGGATGAAGCCTTTCGCAAGTTCCTGAAG GGCCTGGCTTCCCGAAAGCCCCTTGTGCTGTGTGGAGACCTCAATGTGGCACATGAAGAA ATTGACCTTCGCAACCCCAAGGGGAACAAAAAGAATGCTGGCTTCACGCCACAAGAGCGC CAAGGCTTCGGGGAATTACTGCAGGCTGTGCCACTGGCTGACAGCTTTAGGCACCTCTAC CCCAACACACCCTATGCCTACACCTTTTGGACTTATATGATGAATGCTCGATCCAAGAAT GTTGGTTGGCGCCTTGATTACTTTTTGTTGTCCCACTCTCTGTTACCTGCATTGTGTGAC AGCAAGATCCGTTCCAAGGCCCTCGGCAGTGATCACTGTCCTATCACCCTATACCTAGCA CTGTGACACCACCCCTAAATCACTTTGAGCCTGGGAAATAAGCCCCCTCAACTACCATTC CTTCTTTAAACACTCTTCAGAGAAATCTGCATTCTATTTCTCATGTATAAAACTAGGAAT CCTCCAACCAGGCTCCTGTGATAGAGTTCTTTTAAGCCCAAGATTTTTTATTTGAGGGTT TTTTGTTTTTTAAAAAAAAATTGAACAAAGACTACTAATGACTTTGTTTGAATTATCCAC ATGAAAATAAAGAGCCATAGTTTCAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_080648 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_080648.1, NP_542379.1 |
RefSeq Size | 1501 bp |
RefSeq ORF | 957 bp |
Locus ID | 328 |
UniProt ID | P27695 |
Cytogenetics | 14q11.2 |
Domains | Exo_endo_phos |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
Protein Pathways | Base excision repair |
Summary | The APEX gene encodes the major AP endonuclease in human cells. It encodes the APEX endonuclease, a DNA repair enzyme with apurinic/apyrimidinic (AP) activity. Such AP activity sites occur frequently in DNA molecules by spontaneous hydrolysis, by DNA damaging agents or by DNA glycosylases that remove specific abnormal bases. The AP sites are the most frequent pre-mutagenic lesions that can prevent normal DNA replication. Splice variants have been found for this gene; all encode the same protein. Disruptions in the biological functions related to APEX are associated with many various malignancies and neurodegenerative diseases.[provided by RefSeq, Dec 2019] Transcript Variant: This variant (2) uses a different donor splice site for exon 1 when compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC201208 | APEX1 (Myc-DDK-tagged)-Human APEX nuclease (multifunctional DNA repair enzyme) 1 (APEX1), transcript variant 2 | 10 ug |
$300.00
|
|
RC201208L1 | Lenti ORF clone of Human APEX nuclease (multifunctional DNA repair enzyme) 1 (APEX1), transcript variant 2, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC201208L2 | Lenti ORF clone of Human APEX nuclease (multifunctional DNA repair enzyme) 1 (APEX1), transcript variant 2, mGFP tagged | 10 ug |
$600.00
|
|
RC201208L3 | Lenti ORF clone of Human APEX nuclease (multifunctional DNA repair enzyme) 1 (APEX1), transcript variant 2, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC201208L4 | Lenti ORF clone of Human APEX nuclease (multifunctional DNA repair enzyme) 1 (APEX1), transcript variant 2, mGFP tagged | 10 ug |
$600.00
|
|
RG201208 | APEX1 (tGFP-tagged) - Human APEX nuclease (multifunctional DNA repair enzyme) 1 (APEX1), transcript variant 2 | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.