MAD2L1 binding protein (MAD2L1BP) (NM_014628) Human Untagged Clone

SKU
SC319109
MAD2L1BP (untagged)-Human MAD2L1 binding protein (MAD2L1BP), transcript variant 2
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MAD2L1 binding protein
Synonyms CMT2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_014628.2 GTCGTGATGGCGGCGCCGGAGGCGGAGGTTCTGTCCTCAGCCGCAGTCCCTGATTTGGAG
TGGTATGAGAAGTCCGAAGAAACTCACGCCTCCCAGATAGAACTACTTGAGACAAGCTCT
ACGCAGGAACCTCTCAACGCTTCGGAGGCCTTTTGCCCAAGAGACTGCATGGTACCAGTG
GTGTTTCCTGGGCCTGTGAGCCAGGAAGGCTGCTGTCAGTTTACTTGTGAACTTCTAAAG
CATATCATGTATCAACGCCAGCAGCTCCCTCTGCCCTATGAACAGCTTAAGCACTTTTAC
CGAAAACCTTCTCCCCAGGCAGAGGAGATGCTGAAGAAGAAACCTCGGGCCACCACTGAG
GTGAGCAGCAGGAAATGCCAACAAGCCCTGGCAGAACTGGAGAGTGTCCTCAGCCACCTG
GAGGACTTCTTTGCACGGACACTAGTACCGCGAGTGCTGATTCTCCTTGGGGGCAATGCC
CTAAGCCCCAAGGAGTTCTATGAACTCGACTTGTCTCTGCTGGCCCCCTACAGCGTGGAC
CAGAGCCTGAGCACAGCAGCTTGTTTGCGCCGTCTCTTCCGAGCCATATTCATGGCTGAT
GCCTTTAGCGAGCTTCAGGCTCCTCCACTCATGGGCACCGTCGTCATGGCACAGGGACAC
CGCAACTGTGGAGAAGATTGGTTTCGACCCAAGCTCAACTATCGAGTGCCCAGCCGGGGC
CATAAACTGACTGTGACCCTGTCATGTGGCAGACCTTCCATCCGAACCACGGCTTGGGAA
GACTACATTTGGTTCCAGGCACCAGTGACATTTAAAGGCTTCCGCGAGTGAATGAGTGCT
TCTTAATCCTAAAAACACAATGGCTGAATTATCTTTCTCCATGTGGCGCTGAATCACCCA
TCTGGTTTGGAGCTAGAGTTGCTTCCTGGTGAGAGAGGAAGCAACTCTCCTTCTGGTTGT
CTGCCTCCCCTCAGATTTCCTGATAGGCTGATGGCATGTGGCTGTGACTGTGACTGTAAT
CATTGCTGAACAACATCTCTTTGAATCAAAGGTTGATTTTCCCAGAGGGTGCTGGGTCAG
GCATTTCTATTAGGAGTTGGAAAGCAAAAATGGGTCCATAGACACTCTATGGAGGTGTCC
CTTTCTGCTCTTTGCTGTGTCCTTTCAGAATTTTTACCAGGAACATAATGTGGATGTGAC
TTATGAACTTAAATATAAAATAAATAGATTCTTATTATAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_014628
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014628.2, NP_055443.1
RefSeq Size 1283 bp
RefSeq ORF 825 bp
Locus ID 9587
UniProt ID Q15013
Cytogenetics 6p21.1
Protein Families Druggable Genome
Summary The protein encoded by this gene was identified as a binding protein of the MAD2 mitotic arrest deficient-like 1 (MAD2/MAD2L1). MAD2 is a key component of the spindle checkpoint that delays the onset of anaphase until all the kinetochores are attached to the spindle. This protein may interact with the spindle checkpoint and coordinate cell cycle events in late mitosis. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant differs in the 5' region compared to variant 1, which includes a part of the coding sequence. The resulting isoform (2) has a distinct and shorter N-terminus, as compared to isoform 1.
Write Your Own Review
You're reviewing:MAD2L1 binding protein (MAD2L1BP) (NM_014628) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202640 MAD2L1BP (Myc-DDK-tagged)-Human MAD2L1 binding protein (MAD2L1BP), transcript variant 2 10 ug
$300.00
RC202640L1 Lenti ORF clone of Human MAD2L1 binding protein (MAD2L1BP), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC202640L2 Lenti ORF clone of Human MAD2L1 binding protein (MAD2L1BP), transcript variant 2, mGFP tagged 10 ug
$600.00
RC202640L3 Lenti ORF clone of Human MAD2L1 binding protein (MAD2L1BP), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC202640L4 Lenti ORF clone of Human MAD2L1 binding protein (MAD2L1BP), transcript variant 2, mGFP tagged 10 ug
$600.00
RG202640 MAD2L1BP (tGFP-tagged) - Human MAD2L1 binding protein (MAD2L1BP), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.