STARD5 (NM_181900) Human Untagged Clone

SKU
SC319080
STARD5 (untagged)-Human StAR-related lipid transfer (START) domain containing 5 (STARD5)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol STARD5
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_181900.2 CGCAGCTAAGCGCAGCTCCCGACGCAATGGACCCGGCGCTGGCAGCCCAGATGAGCGAGG
CTGTGGCCGAGAAGATGCTCCAGTACCGGCGGGACACAGCAGGCTGGAAGATTTGCCGGG
AAGGCAATGGAGTTTCAGTTTCCTGGAGGCCATCTGTGGAGTTTCCAGGGAACCTGTACC
GAGGAGAAGGCATTGTATATGGGACACTAGAGGAGGTGTGGGACTGTGTGAAGCCAGCTG
TTGGAGGCCTACGAGTGAAGTGGGATGAGAATGTGACCGGTTTTGAAATTATCCAAAGCA
TCACTGACACCCTGTGTGTAAGCAGAACCTCCACTCCCTCCGCTGCCATGAAGCTCATTT
CTCCCAGAGATTTTGTGGACTTGGTGCTAGTCAAGAGATATGAGGATGGGACCATCAGTT
CCAACGCCACCCATGTGGAGCATCCGTTATGTCCCCCGAAGCCAGGTTTTGTGAGAGGAT
TTAACCATCCTTGTGGTTGCTTCTGTGAACCTCTTCCAGGGGAACCCACCAAGACCAACC
TGGTCACATTCTTCCATACCGACCTCAGCGGTTACCTCCCACAGAACGTGGTGGACTCCT
TCTTCCCCCGCAGCATGACCCGGTTTTATGCCAACCTTCAGAAAGCAGTGAAGCAATTCC
ATGAGTAATGCTATCGTTACTTCTTGGCAAAGAACTCCCGTGACTCATCGAGGAGCTCCA
GCTGTTGGGACACCAAGGAGCCTGGGAGCACGCAGAGGCCTGTGTTCACTCTTTGGAACA
AGCTGATGGACTGCGCATCTCTGAGAATGCCAACCAGAGGCGGCAGCCCACCCTTCCTGC
CTCCTGCCCCACTCAGGGTTGGCGTGTGATGAGCCATTCATGTGTTCCAAACTCCATCTG
CCTGTTACCCAAACGCCTCTCCTGGCAGGGTAGACCCAGGCCTCTAACCATCTGACAGAG
ACTCGGCCTGGACACCATGCGATGCACTCTGGCACCAAGGCTTTATGTGCCCATCACTCT
CAGAGACCACGTTTCTCTGACTGTCATAGAGAATCATCATCGCCACTGAAAACCAGGCCC
TGTTGCCTTTTAAGCATGTACCGCTCCCTCAGTCCTGTGCTGCAGCCCCCCAAATATATT
TTTCTGATATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAC
Restriction Sites Please inquire
ACCN NM_181900
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_181900.2, NP_871629.1
RefSeq Size 1344 bp
RefSeq ORF 642 bp
Locus ID 80765
UniProt ID Q9NSY2
Cytogenetics 15q25.1
Summary Proteins containing a steroidogenic acute regulatory-related lipid transfer (START) domain are often involved in the trafficking of lipids and cholesterol between diverse intracellular membranes. This gene is a member of the StarD subfamily that encodes START-related lipid transfer proteins. The protein encoded by this gene is a cholesterol transporter and is also able to bind and transport other sterol-derived molecules related to the cholesterol/bile acid biosynthetic pathways such as 25-hydroxycholesterol. Its expression is upregulated during endoplasmic reticulum (ER) stress. The protein is thought to act as a cytosolic sterol transporter that moves cholesterol between intracellular membranes such as from the cytoplasm to the ER and from the ER to the Golgi apparatus. Alternative splicing of this gene produces multiple transcript variants. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (1) represents the longer transcript.
Write Your Own Review
You're reviewing:STARD5 (NM_181900) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202407 STARD5 (Myc-DDK-tagged)-Human StAR-related lipid transfer (START) domain containing 5 (STARD5) 10 ug
$300.00
RC202407L1 Lenti ORF clone of Human StAR-related lipid transfer (START) domain containing 5 (STARD5), Myc-DDK-tagged 10 ug
$600.00
RC202407L2 Lenti ORF clone of Human StAR-related lipid transfer (START) domain containing 5 (STARD5), mGFP tagged 10 ug
$600.00
RC202407L3 Lenti ORF clone of Human StAR-related lipid transfer (START) domain containing 5 (STARD5), Myc-DDK-tagged 10 ug
$600.00
RC202407L4 Lenti ORF clone of Human StAR-related lipid transfer (START) domain containing 5 (STARD5), mGFP tagged 10 ug
$600.00
RG202407 STARD5 (tGFP-tagged) - Human StAR-related lipid transfer (START) domain containing 5 (STARD5) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.