UBXN1 (NM_015853) Human Untagged Clone

SKU
SC319056
UBXN1 (untagged)-Human UBX domain protein 1 (UBXN1)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol UBXN1
Synonyms 2B28; SAKS1; UBXD10
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_015853.3 GGCTGCTATAGAGCCGGGTGAGAGAGCGAGCGCCCGTCGGCGGGTGTCGAGGGCGGGTTG
CCTCGCGCTGACCCTTCCCGCCCTCCTTCTCGTCACACACCAGGTCCCCGCGGAAGCCGC
GGTGTCGGCGCCATGGCGGAGCTGACGGCTCTTGAGAGTCTCATCGAGATGGGCTTCCCC
AGGGGACGCGCGGAGAAGGCTCTGGCCCTCACAGGGAACCAGGGCATCGAGGCTGCGATG
GACTGGCTGATGGAGCACGAAGACGACCCCGATGTGGACGAGCCTTTAGAGACTCCCCTT
GGACATATCCTGGGACGGGAGCCCACTTCCTCAGAGCAAGGCGGCCTTGAAGGATCTGGT
TCTGCTGCCGGAGAAGGCAAACCCGCTTTGAGTGAAGAGGAAAGACAGGAACAAACTAAG
AGGATGTTGGAGCTGGTGGCCCAGAAGCAGCGGGAGCGTGAAGAAAGAGAGGAACGGGAG
GCATTGGAACGGGAACGGCAGCGCAGGAGACAAGGGCAAGAGTTGTCAGCAGCACGACAG
CGGCTACAGGAAGATGAGATGCGCCGGGCTGCTGAGGAGAGGCGGAGGGAAAAGGCCGAG
GAGTTAGCAGCCAGACAAAGAGTTAGAGAAAAGATCGAGAGGGACAAAGCAGAGAGAGCC
AAGAAGTATGGTGGCAGTGTGGGCTCTCAGCCACCCCCAGTGGCACCAGAGCCAGGTCCT
GTTCCCTCTTCTCCCAGCCAGGAGCCTCCCACCAAGCGGGAGTATGACCAGTGTCGCATA
CAGGTCAGGCTGCCAGATGGGACCTCACTGACCCAGACGTTCCGGGCCCGGGAACAGCTG
GCAGCTGTGAGGCTCTATGTGGAGCTCCACCGTGGGGAGGAACTAGGTGGGGGCCAGGAC
CCTGTGCAATTGCTCAGTGGCTTCCCCAGACGGGCCTTCTCAGAAGCTGACATGGAGCGG
CCTCTGCAGGAGCTGGGTATGGCTGCAAGACTAGAAACCAGGACTAGAAACTGGGGGAGT
AGGGAGGCATGCCTAGGAAAAGGAGGGATGCAAAGAGAAGGGGCTTTGTGAACATGGTGC
AAGGCCAGGAATTTTGGGAGCAAAAACCAAGTATCCTTGTGGTTCAAGCCTGTTTTCTTC
CATCTTCAGGACTCGTGCCTTCTGCTGTTCTCATTGTGGCCAAGAAATGTCCCAGCTGAG
GGCCTTTGTCCCATTGTCCCTCTGTGACCCCTTCATCTTTGATAAAGCACTGACATCTCC
TTCCTAATAAATAGACCCTGAGTTCTGTAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_015853
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_015853.3, NP_056937.2
RefSeq Size 1307 bp
RefSeq ORF 939 bp
Locus ID 51035
UniProt ID Q04323
Cytogenetics 11q12.3
Domains UBA, UBX
Protein Families Druggable Genome
Summary Ubiquitin-binding protein that plays a role in the modulation of innate immune response. Blocks both the RIG-I-like receptors (RLR) and NF-kappa-B pathways. Following viral infection, UBXN1 is induced and recruited to the RLR component MAVS. In turn, interferes with MAVS oligomerization, and disrupts the MAVS/TRAF3/TRAF6 signalosome. This function probably serves as a brake to prevent excessive RLR signaling (PubMed:23545497). Interferes with the TNFalpha-triggered NF-kappa-B pathway by interacting with cellular inhibitors of apoptosis proteins (cIAPs) and thereby inhibiting their recruitment to TNFR1 (PubMed:25681446). Prevents also the activation of NF-kappa-B by associating with CUL1 and thus inhibiting NF-kappa-B inhibitor alpha/NFKBIA degradation that remains bound to NF-kappa-B (PubMed:28152074). Interacts with the BRCA1-BARD1 heterodimer and regulates its activity. Specifically binds 'Lys-6'-linked polyubiquitin chains. Interaction with autoubiquitinated BRCA1 leads to the inhibition of the E3 ubiquitin-protein ligase activity of the BRCA1-BARD1 heterodimer (PubMed:20351172). Component of a complex required to couple deglycosylation and proteasome-mediated degradation of misfolded proteins in the endoplasmic reticulum that are retrotranslocated in the cytosol.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
Write Your Own Review
You're reviewing:UBXN1 (NM_015853) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200703 UBXN1 (Myc-DDK-tagged)-Human UBX domain protein 1 (UBXN1) 10 ug
$300.00
RC200703L1 Lenti ORF clone of Human UBX domain protein 1 (UBXN1), Myc-DDK-tagged 10 ug
$600.00
RC200703L2 Lenti ORF clone of Human UBX domain protein 1 (UBXN1), mGFP tagged 10 ug
$600.00
RC200703L3 Lenti ORF clone of Human UBX domain protein 1 (UBXN1), Myc-DDK-tagged 10 ug
$600.00
RC200703L4 Lenti ORF clone of Human UBX domain protein 1 (UBXN1), mGFP tagged 10 ug
$600.00
RG200703 UBXN1 (tGFP-tagged) - Human UBX domain protein 1 (UBXN1) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.