MSX1 (NM_002448) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | MSX1 |
Synonyms | ECTD3; HOX7; HYD1; STHAG1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC317449 representing NM_002448.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCCCGGCTGCTGACATGACTTCTTTGCCACTCGGTGTCAAAGTGGAGGACTCCGCCTTCGGCAAG CCGGCGGGGGGAGGCGCGGGCCAGGCCCCCAGCGCCGCCGCGGCCACGGCAGCCGCCATGGGCGCGGAC GAGGAGGGGGCCAAGCCCAAAGTGTCCCCTTCGCTCCTGCCCTTCAGCGTGGAGGCGCTCATGGCCGAC CACAGGAAGCCGGGGGCCAAGGAGAGCGCCCTGGCGCCCTCCGAGGGCGTGCAGGCGGCGGGTGGCTCG GCGCAGCCACTGGGCGTCCCGCCGGGGTCGCTGGGAGCCCCGGACGCGCCCTCTTCGCCGCGGCCGCTC GGCCATTTCTCGGTGGGGGGACTCCTCAAGCTGCCAGAAGATGCGCTCGTCAAAGCCGAGAGCCCCGAG AAGCCCGAGAGGACCCCGTGGATGCAGAGCCCCCGCTTCTCCCCGCCGCCGGCCAGGCGGCTGAGCCCC CCAGCCTGCACCCTCCGCAAACACAAGACGAACCGTAAGCCGCGGACGCCCTTCACCACCGCGCAGCTG CTGGCGCTGGAGCGCAAGTTCCGCCAGAAGCAGTACCTGTCCATCGCCGAGCGCGCGGAGTTCTCCAGC TCGCTCAGCCTCACTGAGACGCAGGTGAAGATATGGTTCCAGAACCGCCGCGCCAAGGCAAAGAGACTA CAAGAGGCAGAGCTGGAGAAGCTGAAGATGGCCGCCAAGCCCATGCTGCCACCGGCTGCCTTCGGCCTC TCCTTCCCTCTCGGCGGCCCCGCAGCTGTAGCGGCCGCGGCGGGTGCCTCGCTCTACGGTGCCTCTGGC CCCTTCCAGCGCGCCGCGCTGCCTGTGGCGCCCGTGGGACTCTACACGGCCCATGTGGGCTACAGCATG TACCACCTGACATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_002448 |
Insert Size | 912 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_002448.3 |
RefSeq Size | 1940 bp |
RefSeq ORF | 912 bp |
Locus ID | 4487 |
UniProt ID | P28360 |
Cytogenetics | 4p16.2 |
Domains | homeobox |
Protein Families | Druggable Genome, Transcription Factors |
MW | 31.5 kDa |
Summary | This gene encodes a member of the muscle segment homeobox gene family. The encoded protein functions as a transcriptional repressor during embryogenesis through interactions with components of the core transcription complex and other homeoproteins. It may also have roles in limb-pattern formation, craniofacial development, particularly odontogenesis, and tumor growth inhibition. Mutations in this gene, which was once known as homeobox 7, have been associated with nonsyndromic cleft lip with or without cleft palate 5, Witkop syndrome, Wolf-Hirschom syndrome, and autosomoal dominant hypodontia. [provided by RefSeq, Jul 2008] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC205682 | MSX1 (Myc-DDK-tagged)-Human msh homeobox 1 (MSX1) | 10 ug |
$450.00
|
|
RC205682L1 | Lenti ORF clone of Human msh homeobox 1 (MSX1), Myc-DDK-tagged | 10 ug |
$750.00
|
|
RC205682L2 | Lenti ORF clone of Human msh homeobox 1 (MSX1), mGFP tagged | 10 ug |
$750.00
|
|
RC205682L3 | Lenti ORF clone of Human msh homeobox 1 (MSX1), Myc-DDK-tagged | 10 ug |
$750.00
|
|
RC205682L4 | Lenti ORF clone of Human msh homeobox 1 (MSX1), mGFP tagged | 10 ug |
$750.00
|
|
RG205682 | MSX1 (tGFP-tagged) - Human msh homeobox 1 (MSX1) | 10 ug |
$650.00
|
|
SC118632 | MSX1 (untagged)-Human msh homeobox 1 (MSX1) | 10 ug |
$300.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.