NSMCE1 (NM_145080) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | NSMCE1 |
Synonyms | NSE1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC317383 representing NM_145080.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGGGCAGCACAAGGAGAATGGGCGTCATGACTGATGTCCACCGGCGCTTCCTCCAGTTGCTGATG ACCCATGGCGTGCTAGAGGAATGGGACGTGAAGCGCTTGCAGACGCACTGCTACAAGGTCCATGACCGC AATGCCACCGTAGATAAGTTGGAGGACTTCATCAACAACATTAACAGTGTCTTGGAGTCCTTGTATATT GAGATAAAGAGAGGAGTCACGGAAGATGATGGGAGACCCATTTATGCGTTGGTGAATCTTGCTACAACT TCAATTTCCAAAATGGCTACGGATTTTGCAGAGAATGAACTGGATTTGTTTAGAAAGGCTCTGGAACTG ATTATTGACTCAGAAACCGGCTTTGCGTCTTCCACAAACATATTGAACCTGGTTGATCAACTTAAAGGC AAGAAGATGAGGAAGAAGGAAGCGGAGCAGGTGCTGCAGAAGTTTGTTCAAAACAAGTGGCTGATTGAG AAGGAAGGGGAGTTCACCCTGCACGGCCGGGCCATCCTGGAGATGGAGCAATACATCCGGGAGACGTAC CCCGACGCGGTGAAGATCTGCAATATCTGTCACAGCCTCCTCATCCAGGGTCAAAGCTGCGAAACCTGT GGGATCAGGATGCACTTACCCTGCGTGGCCAAGTACTTCCAGTCGAATGCTGAACCGCGCTGCCCCCAC TGCAACGACTACTGGCCCCACGAGATCCCAAAAGTCTTCGACCCTGAGAAGGAGAGGGAGTCTGGTGTC TTGAAATCGAACAAAAAGTCCCTGCGGTCCAGGCAGCATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_145080 |
Insert Size | 801 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_145080.3 |
RefSeq Size | 1079 bp |
RefSeq ORF | 801 bp |
Locus ID | 197370 |
UniProt ID | Q8WV22 |
Cytogenetics | 16p12.1 |
Protein Families | Druggable Genome |
MW | 30.9 kDa |
Summary | RING-type zinc finger-containing E3 ubiquitin ligase that assembles with melanoma antigen protein (MAGE) to catalyze the direct transfer of ubiquitin from E2 ubiquitin-conjugating enzyme to a specific substrate. Within MAGE-RING ubiquitin ligase complex, MAGE stimulates and specifies ubiquitin ligase activity likely through recruitment and/or stabilization of the E2 ubiquitin-conjugating enzyme at the E3:substrate complex. Involved in maintenance of genome integrity, DNA damage response and DNA repair (PubMed:29225034, PubMed:20864041). NSMCE3/MAGEG1 and NSMCE1 ubiquitin ligase are components of SMC5-SMC6 complex and may positively regulate homologous recombination-mediated DNA repair (PubMed:18086888). MAGEF1-NSMCE1 ubiquitin ligase promotes proteasomal degradation of MMS19, a key component of the cytosolic iron-sulfur protein assembly (CIA) machinery. Down-regulation of MMS19 impairs the activity of several DNA repair and metabolism enzymes such as ERCC2/XPD, FANCJ, RTEL1 and POLD1 that require iron-sulfur clusters as cofactors (PubMed:29225034).[UniProtKB/Swiss-Prot Function] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC218073 | NSMCE1 (Myc-DDK-tagged)-Human non-SMC element 1 homolog (S. cerevisiae) (NSMCE1) | 10 ug |
$300.00
|
|
RC218073L3 | Lenti ORF clone of Human non-SMC element 1 homolog (S. cerevisiae) (NSMCE1), Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC218073L4 | Lenti ORF clone of Human non-SMC element 1 homolog (S. cerevisiae) (NSMCE1), mGFP tagged | 10 ug |
$600.00
|
|
RG218073 | NSMCE1 (tGFP-tagged) - Human non-SMC element 1 homolog (S. cerevisiae) (NSMCE1) | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
SC100078 | NSMCE1 (untagged)-Human non-SMC element 1 homolog (S. cerevisiae) (NSMCE1) | 10 ug |
$300.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.