CEACAM3 (NM_001815) Human Untagged Clone
SKU
SC317359
CEACAM3 (untagged)-Human carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3)
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | CEACAM3 |
Synonyms | CD66D; CEA; CGM1; W264; W282 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001815, the custom clone sequence may differ by one or more nucleotides
ATGGGGCCCCCCTCAGCCTCTCCCCACAGAGAATGCATCCCCTGGCAGGGGCTTCTGCTCACAGCCTCAC TTCTAAACTTCTGGAACCCGCCCACCACTGCCAAGCTCACTATTGAATCCATGCCGCTCAGTGTCGCAGA GGGGAAGGAGGTGCTTCTACTTGTCCACAATCTGCCCCAGCATCTTTTTGGCTACAGCTGGTACAAAGGG GAAAGAGTGGATGGCAACAGTCTAATTGTAGGATATGTAATAGGAACTCAACAAGCTACCCCAGGGGCCG CATACAGCGGTCGAGAGACAATATACACCAATGCATCCCTGCTGATCCAGAATGTCACCCAGAATGACAT AGGATTCTACACCCTACAAGTCATAAAGTCAGATCTTGTGAATGAAGAAGCAACTGGACAGTTCCATGTA TACCAAGAAAATGCCCCAGGCCTTCCTGTGGGGGCCGTCGCCGGCATCGTGACCGGGGTCCTGGTCGGAG TGGCGCTGGTGGCCGCGCTGGTGTGTTTCCTGCTCCTTGCCAAAACTGGAAGAACCAGCATCCAGCGTGA CCTCAAGGAGCAGCAGCCCCAAGCCCTTGCCCCTGGCCGTGGTCCCTCCCACAGCTCTGCCTTCTCGATG TCCCCTCTCTCCACTGCCCAGGCCCCCCTACCCAACCCCAGGACAGCAGCTTCCATCTATGAGGAATTGC TAAAACATGACACAAACATTTACTGCCGGATGGACCACAAAGCAGAAGTGGCTTCTTAG |
Restriction Sites | Please inquire |
ACCN | NM_001815 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001815.2, NP_001806.2 |
RefSeq Size | 1151 bp |
RefSeq ORF | 759 bp |
Locus ID | 1084 |
UniProt ID | P40198 |
Cytogenetics | 19q13.2 |
Protein Families | Transmembrane |
Summary | This gene encodes a member of the family of carcinoembryonic antigen-related cell adhesion molecules (CEACAMs), which are used by several bacterial pathogens to bind and invade host cells. The encoded transmembrane protein directs phagocytosis of several bacterial species that is dependent on the small GTPase Rac. It is thought to serve an important role in controlling human-specific pathogens by the innate immune system. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2013] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC217469 | CEACAM3 (Myc-DDK-tagged)-Human carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3) | 10 ug |
$450.00
|
|
RC217469L1 | Lenti ORF clone of Human carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3), Myc-DDK-tagged | 10 ug |
$750.00
|
|
RC217469L2 | Lenti ORF clone of Human carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3), mGFP tagged | 10 ug |
$750.00
|
|
RC217469L3 | Lenti ORF clone of Human carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3), Myc-DDK-tagged | 10 ug |
$750.00
|
|
RC217469L4 | Lenti ORF clone of Human carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3), mGFP tagged | 10 ug |
$750.00
|
|
RG217469 | CEACAM3 (tGFP-tagged) - Human carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3) | 10 ug |
$650.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.