TIP30 (HTATIP2) (NM_001098522) Human Untagged Clone

SKU
SC316348
HTATIP2 (untagged)-Human HIV-1 Tat interactive protein 2, 30kDa (HTATIP2), transcript variant 4
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TIP30
Synonyms CC3; SDR44U1; TIP30
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC316348 representing NM_001098522.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCGAAACAGAAGCCCTGTCGAAGCTTCGGGAAGACTTCAGGATGCAGAATAAATCCGTCTTTATT
TTGGGCGCCAGCGGAGAAACCGGCAGAGTGCTCTTAAAGGAAATCCTGGAGCAGGGCCTGTTTTCCAAA
GTCACGCTCATTGGCCGGAGGAAGCTCACCTTCGACGAGGAAGCTTATAAAAATGTGAATCAAGAAGTG
GTGGACTTTGAAAAGTTGGATGACTACGCCTCTGCCTTTCAAGGTCATGATGTTGGATTCTGTTGCCTG
GGTACCACCAGAGGGAAAGCTGGGGCGGAGGGATTTGTTCGTGTTGACCGAGATTATGTGCTGAAGTCT
GCAGAGCTGGCAAAAGCTGGAGGGTGCAAACATTTCAACTTGCTATCCTCTAAAGGAGCTGATAAATCA
AGCAATTTTTTATATCTACAAGTTAAGGGAGAAGTAGAAGCCAAGGTTGAAGAATTAAAATTTGATCGT
TACTCTGTATTTAGGCCTGGAGTTCTGTTATGTGATAGGCAAGAATCTCGCCCAGGTGAATGGCTGGTT
AGAAAGTTCTTTGGCTCCTTACCAGACTCTTGGGCCAGTGGGCATTCTGTGCCTGTGGTGACCGTGGTT
AGAGCAATGCTGAACAATGTGGTGAGACCAAGAGACAAGCAGATGGAACTGCTGGAGAACAAGGCCATC
CATGACCTGGGGAAAGCGCATGGCTCTCTCAAGCCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001098522
Insert Size 729 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001098522.1
RefSeq Size 1719 bp
RefSeq ORF 729 bp
Locus ID 10553
UniProt ID Q9BUP3
Cytogenetics 11p15.1
Protein Families Druggable Genome
MW 27 kDa
Summary Oxidoreductase required for tumor suppression. NAPDH-bound form inhibits nuclear import by competing with nuclear import substrates for binding to a subset of nuclear transport receptors. May act as a redox sensor linked to transcription through regulation of nuclear import. Isoform 1 is a metastasis suppressor with proapoptotic as well as antiangiogenic properties. Isoform 2 has an antiapoptotic effect.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) has an alternate 5' end and differs in the 5' UTR, compared to variant 1. These differences cause translation initiation at a downstream AUG and an isoform (b, also known as CC3) with a shorter N-terminus compared to isoform a. Variants 2, 3 and 4 encode the same isoform.
Write Your Own Review
You're reviewing:TIP30 (HTATIP2) (NM_001098522) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212332 HTATIP2 (Myc-DDK-tagged)-Human HIV-1 Tat interactive protein 2, 30kDa (HTATIP2), transcript variant 4 10 ug
$300.00
RC212332L3 Lenti ORF clone of Human HIV-1 Tat interactive protein 2, 30kDa (HTATIP2), transcript variant 4, Myc-DDK-tagged 10 ug
$600.00
RC212332L4 Lenti ORF clone of Human HIV-1 Tat interactive protein 2, 30kDa (HTATIP2), transcript variant 4, mGFP tagged 10 ug
$600.00
RG212332 HTATIP2 (tGFP-tagged) - Human HIV-1 Tat interactive protein 2, 30kDa (HTATIP2), transcript variant 4 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.