PPP1R1C (NM_001080545) Human Untagged Clone

SKU
SC315666
PPP1R1C (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 1C (PPP1R1C)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PPP1R1C
Synonyms IPP5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC315666 representing NM_001080545.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGCCCAACAGTCCCAAAAAGATACAGTTTGCCGTGCCTGTATTCCAGAGTCAGATTGCACCTGAA
GCAGCAGAGCAGATCAGGAAAAGAAGACCTACACCAGCATCACTTGTGATTCTCAATGAGCATAACCCC
CCAGAAATAGATGACAAGAGGGGGCCCAACACACAAGGGGAATTACAGAATGCATCCCCTAAGCAAAGG
AAGCAGAGTGTGTACACACCACCCACCATAAAAGGGGTTAAGCATCTGAAAGGCCAGAATGAATCAGCA
TTCCCTGAAGAAGAAGAAGGCACCAATGAAAGAGAGGAGCAGCGGGACCATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001080545
Insert Size 330 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001080545.2
RefSeq Size 1078 bp
RefSeq ORF 330 bp
Locus ID 151242
UniProt ID Q8WVI7
Cytogenetics 2q31.3-q32.1
Protein Families Druggable Genome, Phosphatase
MW 12.3 kDa
Summary Protein phosphatase-1 (PP1) is a major serine/threonine phosphatase that regulates a variety of cellular functions. PP1 consists of a catalytic subunit (see PPP1CA; MIM 176875) and regulatory subunits that determine the subcellular localization of PP1 or regulate its function. PPP1R1C belongs to a group of PP1 inhibitory subunits that are themselves regulated by phosphorylation (Wang et al., 2008 [PubMed 18310074]).[supplied by OMIM, Feb 2010]
Transcript Variant: This variant (3) uses an alternate in-frame splice site in the 5' coding region and differs in the 3' UTR compared to variant 1. The resulting protein is shorter compared to isoform 1. Variants 2 and 3 encode the same protein (isoform 2). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Write Your Own Review
You're reviewing:PPP1R1C (NM_001080545) Human Untagged Clone
Your Rating
SKU Description Size Price
RC205047 PPP1R1C (Myc-DDK-tagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 1C (PPP1R1C) 10 ug
$150.00
RC205047L3 Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 1C (PPP1R1C), Myc-DDK-tagged 10 ug
$450.00
RC205047L4 Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 1C (PPP1R1C), mGFP tagged 10 ug
$450.00
RG205047 PPP1R1C (tGFP-tagged) - Human protein phosphatase 1, regulatory (inhibitor) subunit 1C (PPP1R1C) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.