TMEM231 (NM_001077418) Human Untagged Clone

SKU
SC315524
TMEM231 (untagged)-Human transmembrane protein 231 (TMEM231), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TMEM231
Synonyms ALYE870; JBTS20; MKS11; PRO1886
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC315524 representing NM_001077418.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCTCTATGAGCTCTTCTCTCACCCGGTCGAGCGCAGTTACCGCGCGGGGCTCTGCTCCAAAGCC
GCGCTGTTCCTGCTGCTGGCCGCTGCGCTCACGTACATCCCGCCGCTGCTGGTGGCCTTCCGGAGCCAC
GGGTTTTGGCTGAAGCGGAGCAGCTACGAGGAGCAGCCGACCGTGCGCTTCCAACACCAGGTGCTGCTC
GTGGCCCTGCTCGGACCCGAAAGCGACGGGTTCCTCGCCTGGAGCACGTTCCCCGCCTTCAACCGGCTG
CAAGGGGATCGCCTGCGCGTCCCGCTCGTTTCGACTAGAGAAGAAGACAGGAACCAGGATGGGAAGACG
GACATGTTACATTTTAAGCTGGAGCTTCCCCTGCAGTCCACGGAGCACGTTCTCGGTGTGCAGCTCATC
CTGACTTTCTCCTATCGATTACACAGGATGGCGACCCTCGTGATGCAGAGCATGGCGTTTCTCCAGTCC
TCCTTTCCTGTCCCGGGATCCCAGTTATACGTGAACGGAGACCTGAGGCTGCAGCAGAAGCAGCCGCTG
AGCTGTGGTGGCCTAGATGCCCGATACAACATATCCGTGATCAACGGGACCAGCCCCTTTGCCTATGAC
TACGACCTCACCCATATTGTTGCTGCCTACCAGGAGAGGAACGTTACCACCGTCCTGAATGATCCCAAC
CCCATCTGGCTGGTGGGCAGGGCCGCAGATGCTCCATTTGTGATTAATGCTATCATCCGATACCCTGTG
GAAGTCATTTCTTATCAGCCAGGATTCTGGGAGATGGTAAAGTTCGCCTGGGTGCAGTATGTCAGCATC
CTGCTTATCTTCCTCTGGGTGTTTGAAAGAATCAAGATCTTCGTGTTTCAGAATCAGGTGGTGACCACC
ATTCCTGTGACAGTGACGCCCCGGGGAGACTTGTGTAAGGAGCACTTATCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001077418
Insert Size 951 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001077418.2
RefSeq Size 2925 bp
RefSeq ORF 951 bp
Locus ID 79583
UniProt ID Q9H6L2
Cytogenetics 16q23.1
Protein Families Transmembrane
MW 36.1 kDa
Summary This gene encodes a transmembrane protein, which is a component of the B9 complex involved in the formation of the diffusion barrier between the cilia and plasma membrane. Mutations in this gene cause Joubert syndrome (JBTS). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (2) uses an alternate splice junction in the 5' coding region which causes translation initiation at an alternate start codon compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
Write Your Own Review
You're reviewing:TMEM231 (NM_001077418) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212590 TMEM231 (Myc-DDK-tagged)-Human transmembrane protein 231 (TMEM231), transcript variant 2 10 ug
$300.00
RC212590L1 Lenti ORF clone of Human transmembrane protein 231 (TMEM231), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC212590L2 Lenti ORF clone of Human transmembrane protein 231 (TMEM231), transcript variant 2, mGFP tagged 10 ug
$600.00
RC212590L3 Lenti ORF clone of Human transmembrane protein 231 (TMEM231), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC212590L4 Lenti ORF clone of Human transmembrane protein 231 (TMEM231), transcript variant 2, mGFP tagged 10 ug
$600.00
RG212590 TMEM231 (tGFP-tagged) - Human transmembrane protein 231 (TMEM231), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.