Protor 1 (PRR5) (NM_015366) Human Untagged Clone

SKU
SC313597
PRR5 (untagged)-Human proline rich 5 (renal) (PRR5), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Protor 1
Synonyms FLJ20185k; PP610; PROTOR-1; PROTOR1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC313597 representing NM_015366.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGTTCGCCCAGCCTCAGTGACCTGGGCAAGAGAGAGCCGGCCGCCGCCGCGGACGAGCGGGGCACG
CAGCAGCGCCGGGCCTGCGCCAACGCCACCTGGAACAGCATCCACAACGGGGTGATCGCCGTCTTCCAG
CGCAAGGGGCTGCCCGACCAGGAGCTCTTCAGCCTCAACGAGGGCGTCCGGCAGCTGTTGAAGACAGAG
CTGGGGTCCTTCTTCACGGAGTACCTGCAGAACCAGCTGCTGACAAAAGGCATGGTGATCCTTCGGGAC
AAGATTCGCTTCTATGAGGGACAGAAGCTGCTGGACTCACTGGCAGAGACCTGGGACTTCTTCTTCAGT
GACGTGCTGCCCATGCTGCAGGCCATCTTCTACCCGGTGCAGGGCAAGGAGCCATCGGTGCGCCAGCTG
GCCCTGCTGCACTTCCGGAATGCCATCACCCTCAGTGTGAAGCTAGAGGATGCGCTGGCCCGGGCCCAT
GCCCGTGTGCCCCCTGCCATCGTGCAGATGCTGCTGGTGCTGCAGGGGGTACATGAGTCCAGGGGCGTG
ACTGAGGACTACCTGCGCCTGGAGACGCTGGTCCAGAAGGTGGTGTCGCCATACCTGGGCACCTACGGC
CTCCACTCCAGCGAGGGGCCCTTCACCCATTCCTGCATCCTGGAAAAGCGCCTCCTCCGCCGCTCCCGC
TCGGGGGACGTGCTGGCCAAGAACCCTGTGGTGCGCTCCAAGAGCTACAACACGCCTCTGCTGAACCCC
GTGCAGGAGCACGAGGCGGAGGGCGCGGCGGCCGGCGGTACCAGCATCCGCAGGCACTCTGTGTCGGAG
ATGACGTCCTGCCCCGAGCCTCAGGGCTTCTCCGACCCGCCCGGCCAGGGCCCCACCGGGACCTTCAGG
TCCTCCCCGGCGCCCCACTCAGGGCCCTGCCCCAGCAGACTGTACCCCACGACCCAGCCCCCTGAGCAG
GGCTTGGATCCCACCCGCAGCTCCCTGCCCCGCTCCAGCCCGGAGAACCTGGTGGACCAGATCCTGGAG
TCCGTGGACTCGGATTCTGAAGGGATTTTCATTGACTTTGGCCGGGGCCGGGGCTCTGGCATGTCCGAC
TTGGAGGGCTCTGGGGGCCGGCAGAGTGTCGTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_015366
Insert Size 1140 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_015366.3
RefSeq Size 2017 bp
RefSeq ORF 1140 bp
Locus ID 55615
UniProt ID P85299
Cytogenetics 22q13.31
Domains RhoGAP, SEC14
MW 41.6 kDa
Summary This gene encodes a protein with a proline-rich domain. This gene is located in a region of chromosome 22 reported to contain a tumor suppressor gene that may be involved in breast and colorectal tumorigenesis. The protein is a component of the mammalian target of rapamycin complex 2 (mTORC2), and it regulates platelet-derived growth factor (PDGF) receptor beta expression and PDGF signaling to Akt and S6K1. Alternative splicing and the use of alternative promoters results in transcripts encoding different isoforms. Read-through transcripts from this gene into the downstream Rho GTPase activating protein 8 (ARHGAP8) gene also exist, which led to the original description of PRR5 and ARHGAP8 being a single gene. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. Both variants 2 and 3 encode the same isoform (2).
Write Your Own Review
You're reviewing:Protor 1 (PRR5) (NM_015366) Human Untagged Clone
Your Rating
SKU Description Size Price
RC217823 PRR5 (Myc-DDK-tagged)-Human proline rich 5 (renal) (PRR5), transcript variant 2 10 ug
$457.00
RC217823L3 Lenti ORF clone of Human proline rich 5 (renal) (PRR5), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC217823L4 Lenti ORF clone of Human proline rich 5 (renal) (PRR5), transcript variant 2, mGFP tagged 10 ug
$757.00
RG217823 PRR5 (tGFP-tagged) - Human proline rich 5 (renal) (PRR5), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.