PHC2 (NM_004427) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | PHC2 |
Synonyms | EDR2; HPH2; PH2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC312947 representing NM_004427.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACCTCAGGGAACGGAAACTCTGCCTCCAGCATCGCCGGCACTGCCCCCCAGAATGGTGAGAATAAA CCACCACAGGCCATTGTGAAACCCCAAATCCTGACGCATGTTATCGAAGGGTTTGTGATCCAGGAGGGG GCGGAGCCTTTCCCGGTGGGACGCTCGTCCCTGCTGGTGGGGAATCTCAAGAAGAAGTATGCACAGGGG TTCCTGCCTGAGAAACTTCCACAGCAGGATCACACCACCACCACTGACTCGGAGATGGAGGAGCCCTAT CTGCAAGAATCCAAAGAGGAGGGTGCTCCCCTCAAACTCAAGTGTGAGCTCTGTGGCCGGGTGGACTTT GCCTATAAGTTCAAGCGTTCCAAGCGCTTCTGTTCCATGGCTTGTGCAAAGAGGTACAACGTGGGATGC ACCAAACGGGTGGGACTTTTCCACTCAGACCGGAGCAAGCTGCAGAAGGCAGGAGCTGCGACCCACAAC CGCCGTCGGGCCAGCAAAGCCAGTCTGCCACCACTTACCAAGGATACCAAGAAGCAGCCAACAGGCACT GTGCCCCTTTCGGTTACTGCTGCTTTGCAGCTAACACACAGCCAGGAAGACTCCAGCCGTTGCTCAGAT AACTCAAGCTATGAGGAACCCTTGTCACCCATCTCAGCCAGCTCATCTACTTCCCGCCGGCGACAAGGC CAGCGGGACCTGGAGCTCCCCGACATGCATATGCGGGACCTGGTGGGCATGGGACACCACTTCCTGCCA AGTGAGCCCACCAAGTGGAATGTAGAAGACGTCTACGAATTCATCCGCTCTCTGCCAGGCTGCCAGGAG ATAGCAGAGGAATTCCGTGCCCAGGAAATCGACGGGCAAGCCCTGCTGCTGCTCAAGGAGGACCACCTG ATGAGCGCCATGAACATCAAGCTGGGGCCCGCCCTGAAGATCTACGCCCGCATCAGCATGCTCAAGGAC TCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_004427 |
Insert Size | 972 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_004427.3 |
RefSeq Size | 2566 bp |
RefSeq ORF | 972 bp |
Locus ID | 1912 |
UniProt ID | Q8IXK0 |
Cytogenetics | 1p35.1 |
MW | 35.8 kDa |
Summary | In Drosophila melanogaster, the 'Polycomb' group (PcG) of genes are part of a cellular memory system that is responsible for the stable inheritance of gene activity. PcG proteins form a large multimeric, chromatin-associated protein complex. The protein encoded by this gene has homology to the Drosophila PcG protein 'polyhomeotic' (Ph) and is known to heterodimerize with EDR1 and colocalize with BMI1 in interphase nuclei of human cells. The specific function in human cells has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (b) has a shorter N-terminus compared to isoform a. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC212697 | PHC2 (Myc-DDK-tagged)-Human polyhomeotic homolog 2 (Drosophila) (PHC2), transcript variant 2 | 10 ug |
$300.00
|
|
RC212697L3 | Lenti ORF clone of Human polyhomeotic homolog 2 (Drosophila) (PHC2), transcript variant 2, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC212697L4 | Lenti ORF clone of Human polyhomeotic homolog 2 (Drosophila) (PHC2), transcript variant 2, mGFP tagged | 10 ug |
$600.00
|
|
RG212697 | PHC2 (tGFP-tagged) - Human polyhomeotic homolog 2 (Drosophila) (PHC2), transcript variant 2 | 10 ug |
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.