Retinol dehydrogenase 16 (RDH16) (NM_003708) Human Untagged Clone

SKU
SC312933
RDH16 (untagged)-Human retinol dehydrogenase 16 (all-trans) (RDH16)
$480.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Retinol dehydrogenase 16
Synonyms hRDH-E; RODH-4; SDR9C8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC312933 representing NM_003708.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGGCTCTACCTGGCGGTTTTCGTGGGCCTGTACTACCTTCTGCACTGGTACCGGGAGAGGCAGGTG
CTGAGCCACCTGAGAGATAAGTATGTGTTCATCACGGGCTGTGACTCTGGCTTCGGGAAACTGCTGGCC
AGACAGCTGGATGCACGAGGCTTGCGGGTGCTGGCTGCATGTCTGACGGAGAAAGGAGCCGAGCAGCTG
AGGGGCCAGACTTCAGACAGGCTGGAGACGGTGACCCTGGATGTTACCAAGACAGAGAGCGTTGCTGCA
GCCGCCCAGTGGGTGAAGGAGTGCGTGAGAGACAAAGGACTCTGGGGCCTGGTGAATAATGCTGGCATC
TCCTTGCCCACGGCTCCCAATGAGTTGCTCACCAAGCAGGACTTCGTGACCATACTGGACGTGAACTTG
TTGGGGGTGATTGATGTGACTCTGAGCCTGCTGCCCTTAGTGAGGAGGGCCAGGGGCCGTGTGGTCAAC
GTCTCCAGTGTCATGGGCCGGGTGTCACTTTTTGGTGGAGGCTACTGCATCTCCAAGTATGGCGTGGAA
GCCTTCTCTGACTCCCTCAGGAGGGAACTCTCCTACTTTGGGGTGAAGGTGGCTATGATTGAACCTGGC
TATTTCAAGACTGCTGTGACCAGTAAGGAGAGATTCTTAAAGAGCTTCCTGGAGATTTGGGACCGGTCC
AGTCCAGAGGTCAAGGAGGCCTATGGCGAGAAGTTTGTTGCAGACTATAAGAAATCAGCTGAACAAATG
GAGCAGAAGTGCACACAGGATCTGTCGTTGGTGACCAACTGCATGGAGCATGCGCTGATTGCCTGCCAC
CCCCGTACTCGCTACTCAGCTGGCTGGGATGCCAAGCTTCTCTACCTCCCCATGAGCTACATGCCCACC
TTCCTGGTGGATGCCATTATGTACTGGGTCTCTCCAAGCCCGGCCAAGGCTCTATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_003708
Insert Size 954 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003708.4
RefSeq Size 3478 bp
RefSeq ORF 954 bp
Locus ID 8608
UniProt ID O75452
Cytogenetics 12q13.3
Domains adh_short
Protein Pathways Metabolic pathways, Retinol metabolism
MW 35.7 kDa
Summary Oxidoreductase with a preference for NAD. Oxidizes all-trans-retinol, 9-cis-retinol, 11-cis-retinol and 13-cis-retinol to the corresponding aldehydes (PubMed:10329026, PubMed:12534290, PubMed:9677409). Has higher activity towards CRBP-bound retinol than with free retinol (PubMed:12534290). Oxidizes also 3-alpha-hydroxysteroids. Oxidizes androstanediol and androsterone to dihydrotestosterone and androstanedione. Can also catalyze the reverse reaction (PubMed:10329026, PubMed:9677409, PubMed:29541409).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Write Your Own Review
You're reviewing:Retinol dehydrogenase 16 (RDH16) (NM_003708) Human Untagged Clone
Your Rating
SKU Description Size Price
RC223973 RDH16 (Myc-DDK-tagged)-Human retinol dehydrogenase 16 (all-trans) (RDH16) 10 ug
$450.00
RC223973L1 Lenti-ORF clone of RDH16 (Myc-DDK-tagged)-Human retinol dehydrogenase 16 (all-trans) (RDH16) 10 ug
$750.00
RC223973L2 Lenti-ORF clone of RDH16 (mGFP-tagged)-Human retinol dehydrogenase 16 (all-trans) (RDH16) 10 ug
$750.00
RC223973L3 Lenti-ORF clone of RDH16 (Myc-DDK-tagged)-Human retinol dehydrogenase 16 (all-trans) (RDH16) 10 ug
$750.00
RC223973L4 Lenti-ORF clone of RDH16 (mGFP-tagged)-Human retinol dehydrogenase 16 (all-trans) (RDH16) 10 ug
$750.00
RG223973 RDH16 (tGFP-tagged) - Human retinol dehydrogenase 16 (all-trans) (RDH16) 10 ug
$650.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.