Gasdermin like (GSDMB) (NM_001042471) Human Untagged Clone

SKU
SC311266
GSDMB (untagged)-Human gasdermin B (GSDMB), transcript variant 1
$732.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Gasdermin like
Synonyms GSDMB-1; GSDML; PP4052; PRO2521
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC311266 representing NM_001042471.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTCAGCGTATTTGAGGAAATCACAAGAATTGTAGTTAAGGAGATGGATGCTGGAGGGGATATGATT
GCCGTTAGAAGCCTTGTTGATGCTGATAGATTCCGCTGCTTCCATCTGGTGGGGGAGAAGAGAACTTTC
TTTGGATGCCGGCACTACACAACAGGCCTCACCCTGATGGACATTCTGGACACAGATGGGGACAAGTGG
TTAGATGAACTGGATTCTGGGCTCCAAGGTCAAAAGGCTGAGTTTCAAATTCTGGATAATGTAGACTCA
ACGGGAGAGTTGATAGTGAGATTACCCAAAGAAATAACAATTTCAGGCAGTTTCCAGGGCTTCCACCAT
CAGAAAATCAAGATATCGGAGAACCGGATATCCCAGCAGTATCTGGCTACCCTTGAAAACAGGAAGCTG
AAGAGGGAACTACCCTTTTCATTCCGATCAATTAATACGAGAGAAAACCTGTATCTGGTGACAGAAACT
CTGGAGACGGTAAAGGAGGAAACCCTGAAAAGCGACCGGCAATATAAATTTTGGAGCCAGATCTCTCAG
GGCCATCTCAGCTATAAACACAAGGGCCAAAGGGAAGTGACCATCCCCCCAAATCGGGTCCTGAGCTAT
CGAGTAAAGCAGCTTGTCTTCCCCAACAAGGAGACGATGAAGAAGGATGGTGCTTCATCCTGTTTAGGA
AAGTCTTTGGGTTCGGAGGATTCCAGAAACATGAAGGAGAAGTTGGAGGACATGGAGAGTGTCCTCAAG
GACCTGACAGAGGAGAAGAGAAAAGATGTGCTAAACTCCCTCGCTAAGTGCCTCGGCAAGGAGGATATT
CGGCAGGATCTAGAGCAAAGAGTATCTGAGGTCCTGATTTCCGGGGAGCTACACATGGAGGACCCAGAC
AAGCCTCTCCTAAGCAGCCTTTTTAATGCTGCTGGGGTCTTGGTAGAAGCGCGTGCAAAAGCCATTCTG
GACTTCCTGGATGCCCTGCTAGAGCTGTCTGAAGAGCAGCAGTTTGTGGCTGAGGCCCTGGAGAAGGGG
ACCCTTCCTCTGTTGAAGGACCAGGTGAAATCTGTCATGGAGCAGAACTGGGATGAGCTGGCCAGCAGT
CCTCCTGACATGGACTATGACCCTGAGGCACGAATTCTCTGTGCGCTGTATGTTGTTGTCTCTATCCTG
CTGGAGCTGGCTGAGGGGCCTACCTCTGTCTCTTCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001042471
Insert Size 1212 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001042471.1
RefSeq Size 1578 bp
RefSeq ORF 1212 bp
Locus ID 55876
UniProt ID Q8TAX9
Cytogenetics 17q21.1
MW 45.8 kDa
Summary This gene encodes a member of the gasdermin-domain containing protein family. Other gasdermin-family genes are implicated in the regulation of apoptosis in epithelial cells, and are linked to cancer. Alternative splicing and the use of alternative promoters results in multiple transcript variants. Additional variants have been described, but they are candidates for nonsense-mediated mRNA decay (NMD) and are unlikely to be protein-coding. [provided by RefSeq, Nov 2016]
Transcript Variant: This variant (1) lacks an alternate in-frame exon in the central coding region, compared to variant 3. The resulting isoform (1) lacks an internal segment, compared to isoform 3.
Write Your Own Review
You're reviewing:Gasdermin like (GSDMB) (NM_001042471) Human Untagged Clone
Your Rating
SKU Description Size Price
RC219044 GSDMB (Myc-DDK-tagged)-Human gasdermin B (GSDMB), transcript variant 1 10 ug
$686.00
RC219044L1 Lenti-ORF clone of GSDMB (Myc-DDK-tagged)-Human gasdermin B (GSDMB), transcript variant 1 10 ug
$986.00
RC219044L2 Lenti-ORF clone of GSDMB (mGFP-tagged)-Human gasdermin B (GSDMB), transcript variant 1 10 ug
$986.00
RC219044L3 Lenti-ORF clone of GSDMB (Myc-DDK-tagged)-Human gasdermin B (GSDMB), transcript variant 1 10 ug
$986.00
RC219044L4 Lenti-ORF clone of GSDMB (mGFP-tagged)-Human gasdermin B (GSDMB), transcript variant 1 10 ug
$986.00
RG219044 GSDMB (tGFP-tagged) - Human gasdermin B (GSDMB), transcript variant 1 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.