C2orf60 (TYW5) (NM_001039693) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | C2orf60 |
Synonyms | C2orf60; hTYW5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC310816 representing NM_001039693.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCGGGCAGCACCTCCCGGTACCCCGGCTGGAGGGCGTTTCTCGGGAGCAGTTCATGCAGCACCTC TACCCACAGAGAAAACCTCTTGTGTTGGAAGGGATTGATTTGGGGCCATGTACAAGCAAATGGACAGTG GATTACCTAAGCCAAGTTGGAGGGAAGAAAGAAGTAAAGATTCATGTTGCTGCAGTTGCACAGATGGAC TTCATTAGTAAGAACTTTGTATATAGAACTTTACCTTTTGACCAGTTGGTCCAGAGGGCAGCTGAAGAG AAACATAAAGAATTCTTTGTTTCAGAGGATGAGAAATACTACTTACGGTCACTTGGAGAAGACCCTAGA AAGGATGTTGCAGATATCAGAAAGCAGTTTCCTTTGTTGAAAGGAGATATTAAGTTTCCAGAATTCTTC AAAGAGGAACAGTTCTTTTCCAGTGTTTTTCGAATTAGTTCACCAGGATTACAACTATGGACTCATTAT GATGTAATGGATAATTTGTTAATACAAGTGACAGGAAAAAAGCGTGTTGTACTCTTCAGTCCTCGAGAT GCCCAGTATTTATATTTAAAAGGTACTAAATCAGAAGTACTGAATATAGATAACCCAGACTTGGCTAAA TATCCACTTTTTTCCAAGGCTAGAAGATATGAATGTTCCCTTGAAGCTGGTGATGTATTATTCATTCCT GCTTTATGGTTCCATAATGTAATTTCTGAAGAGTTTGGAGTGGGAGTGAATATCTTTTGGAAGCACCTT CCATCTGAATGCTATGATAAAACAGATACCTATGGAAACAAAGATCCTACAGCAGCATCAAGAGCTGCA CAAATTCTGGACAGAGCCTTGAAAACACTGGCCGAGTTACCAGAGGAATATAGGGACTTCTATGCACGA CGAATGGTCCTACACATTCAAGACAAAGCCTACAGCAAGAACTCTGAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001039693 |
Insert Size | 948 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001039693.2 |
RefSeq Size | 5384 bp |
RefSeq ORF | 948 bp |
Locus ID | 129450 |
UniProt ID | A2RUC4 |
Cytogenetics | 2q33.1 |
MW | 36.5 kDa |
Summary | tRNA hydroxylase that acts as a component of the wybutosine biosynthesis pathway. Wybutosine is a hyper modified guanosine with a tricyclic base found at the 3'-position adjacent to the anticodon of eukaryotic phenylalanine tRNA. Catalyzes the hydroxylation of 7-(a-amino-a-carboxypropyl)wyosine (yW-72) into undermodified hydroxywybutosine (OHyW*). OHyW* being further transformed into hydroxywybutosine (OHyW) by LCMT2/TYW4. OHyW is a derivative of wybutosine found in higher eukaryotes.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and is the protein-coding transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC212399 | TYW5 (Myc-DDK-tagged)-Human tRNA-yW synthesizing protein 5 (TYW5), transcript variant 1 | 10 ug |
$300.00
|
|
RC212399L1 | Lenti ORF clone of Human tRNA-yW synthesizing protein 5 (TYW5), transcript variant 1, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC212399L2 | Lenti ORF clone of Human tRNA-yW synthesizing protein 5 (TYW5), transcript variant 1, mGFP tagged | 10 ug |
$600.00
|
|
RC212399L3 | Lenti ORF clone of Human tRNA-yW synthesizing protein 5 (TYW5), transcript variant 1, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC212399L4 | Lenti ORF clone of Human tRNA-yW synthesizing protein 5 (TYW5), transcript variant 1, mGFP tagged | 10 ug |
$600.00
|
|
RG212399 | TYW5 (tGFP-tagged) - Human tRNA-yW synthesizing protein 5 (TYW5), transcript variant 1 | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.