CCR9 (NM_006641) Human Untagged Clone

SKU
SC310507
CCR9 (untagged)-Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CCR9
Synonyms CC-CKR-9; CDw199; GPR-9-6; GPR28
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC310507 representing NM_006641.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGATGACTATGGCTCTGAATCCACATCTTCCATGGAAGACTACGTTAACTTCAACTTCACTGAC
TTCTACTGTGAGAAAAACAATGTCAGGCAGTTTGCGAGCCATTTCCTCCCACCCTTGTACTGGCTCGTG
TTCATCGTGGGTGCCTTGGGCAACAGTCTTGTTATCCTTGTCTACTGGTACTGCACAAGAGTGAAGACC
ATGACCGACATGTTCCTTTTGAATTTGGCAATTGCTGACCTCCTCTTTCTTGTCACTCTTCCCTTCTGG
GCCATTGCTGCTGCTGACCAGTGGAAGTTCCAGACCTTCATGTGCAAGGTGGTCAACAGCATGTACAAG
ATGAACTTCTACAGCTGTGTGTTGCTGATCATGTGCATCAGCGTGGACAGGTACATTGCCATTGCCCAG
GCCATGAGAGCACATACTTGGAGGGAGAAAAGGCTTTTGTACAGCAAAATGGTTTGCTTTACCATCTGG
GTATTGGCAGCTGCTCTCTGCATCCCAGAAATCTTATACAGCCAAATCAAGGAGGAATCCGGCATTGCT
ATCTGCACCATGGTTTACCCTAGCGATGAGAGCACCAAACTGAAGTCAGCTGTCTTGACCCTGAAGGTC
ATTCTGGGGTTCTTCCTTCCCTTCGTGGTCATGGCTTGCTGCTATACCATCATCATTCACACCCTGATA
CAAGCCAAGAAGTCTTCCAAGCACAAAGCCCTAAAAGTGACCATCACTGTCCTGACCGTCTTTGTCTTG
TCTCAGTTTCCCTACAACTGCATTTTGTTGGTGCAGACCATTGACGCCTATGCCATGTTCATCTCCAAC
TGTGCCGTTTCCACCAACATTGACATCTGCTTCCAGGTCACCCAGACCATCGCCTTCTTCCACAGTTGC
CTGAACCCTGTTCTCTATGTTTTTGTGGGTGAGAGATTCCGCCGGGATCTCGTGAAAACCCTGAAGAAC
TTGGGTTGCATCAGCCAGGCCCAGTGGGTTTCATTTACAAGGAGAGAGGGAAGCTTGAAGCTGTCGTCT
ATGTTGCTGGAGACAACCTCAGGAGCACTCTCCCTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_006641
Insert Size 1074 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006641.3
RefSeq Size 2518 bp
RefSeq ORF 1074 bp
Locus ID 10803
UniProt ID P51686
Cytogenetics 3p21.31
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction
MW 40.7 kDa
Summary The protein encoded by this gene is a G protein-coupled receptor with seven transmembrane domains that belongs to the beta chemokine receptor family. Chemokines and their receptors are key regulators of thymocyte migration and maturation in normal and inflammation conditions. This gene is differentially expressed in T lymphocytes of the small intestine and colon, and its interaction with chemokine 25 contributes to intestinal intra-epithelial lymphocyte homing to the small intestine. This suggests a role for this gene in directing immune responses to different segments of the gastrointestinal tract. This gene and its exclusive ligand, chemokine 25, are overexpressed in a variety of malignant tumors and are closely associated with tumor proliferation, apoptosis, invasion, migration and drug resistance. This gene maps to the chemokine receptor gene cluster. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2020]
Transcript Variant: This variant (B) lacks an internal exon and initiates translation at a downstream, in-frame start codon, compared to variant 1. Variants B and C encode the same isoform (B), which has a shorter N-terminus compared to isoform A.
Write Your Own Review
You're reviewing:CCR9 (NM_006641) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210246 CCR9 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B 10 ug
$457.00
RC210246L1 Lenti ORF clone of Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B, Myc-DDK-tagged 10 ug
$757.00
RC210246L2 Lenti ORF clone of Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B, mGFP tagged 10 ug
$757.00
RC210246L3 Lenti ORF clone of Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B, Myc-DDK-tagged 10 ug
$757.00
RC210246L4 Lenti ORF clone of Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B, mGFP tagged 10 ug
$757.00
RG210246 CCR9 (tGFP-tagged) - Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.