UPF3B (NM_023010) Human Untagged Clone

SKU
SC310355
UPF3B (untagged)-Human UPF3 regulator of nonsense transcripts homolog B (yeast) (UPF3B), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol UPF3B
Synonyms HUPF3B; MRX62; MRX82; MRXS14; RENT3B; UPF3BP1; UPF3BP2; UPF3BP3; Upf3p-X; UPF3X
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC310355 representing NM_023010.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGGAAGAGAAGGAGCACAGGCCTAAGGAGAAGCGAGTAACCCTGTTAACCCCCGCCGGGGCCACA
GGCAGCGGTGGTGGGACCTCGGGGGACAGCTCCAAGGGGGAAGATAAGCAGGATCGCAACAAGGAGAAG
AAAGAAGCGCTGAGCAAGGTGGTAATTCGAAGATTACCTCCCACTTTGACCAAGGAGCAGCTTCAGGAA
CATCTTCAACCTATGCCTGAGCATGATTATTTTGAGTTTTTTTCTAATGATACGAGTTTGTATCCTCAT
ATGTATGCCAGAGCATACATCAACTTTAAAAACCAAGAGGACATTATTTTGTTCAGGGATCGCTTTGAT
GGTTATGTATTCCTTGACAATAAAGGTCAGGAATATCCCGCTATAGTAGAATTTGCACCTTTTCAAAAA
GCTGCAAAAAAGAAGACTAAGAAAAGAGATACCAAAGTCGGGACTATCGATGATGATCCAGAATATAGA
AAGTTTTTGGAAAGTTATGCCACAGATAATGAGAAAATGACATCTACTCCAGAGACACTGCTAGAGGAA
ATAGAAGCAAAAAATAGAGAATTAATAGCTAAAAAGACAACCCCACTTTTGAGCTTCCTGAAAAACAAG
CAGAGAATGAGAGAAGAAAAGAGAGAAGAAAGGAGGAGGAGAGAAATAGAAAGAAAAAGACAAAGAGAA
GAAGAGAGGAGGAAATGGAAAGAAGAAGAGAAACGAAAAAGGAAAGATATAGAAAAGCTAAAGAAGATA
GACAGAATTCCAGAAAGGGACAAATTAAAGGATGAACCAAAGATTAAGCTGCTCAAGAAGCCAGAAAAA
GGAGATGAAAAAGAATTGGACAAAAGAGAAAAAGCCAAGAAATTGGACAAAGAGAATCTCAGTGATGAA
AGAGCCAGTGGGCAAAGTTGTACATTGCCCAAGCGTTCTGATAGCGAACTTAAAGATGAAAAACCAAAG
AGACCTGAAGATGAGAGCGGCAGAGACTATAGGGAGAGGGAACGGGAATATGAACGAGATCAGGAGCGC
ATACTTCGAGAAAGAGAGAGGCTGAAGCGGCAAGAAGAAGAGCGCCGTAGGCAGAAGGAGCGCTATGAG
AAAGAGAAGACTTTTAAGAGAAAAGAAGAAGAAATGAAAAAAGAGAAAGACACACTTCGGGATAAAGGA
AAGAAGGCTGAAAGTACAGAATCAATAGGCAGCTCAGAAAAAACTGAAAAGAAAGAAGAAGTGGTCAAG
AGAGATCGAATAAGAAACAAGGATCGTCCAGCGATGCAGCTTTACCAACCAGGAGCTCGAAGCCGAAAT
CGACTCTGTCCCCCTGATGACAGCACCAAGTCTGGAGATTCAGCAGCAGAAAGGAAGCAGGAAAGTGGT
ATTAGCCATAGAAAAGAAGGAGGAGAGGAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_023010
Insert Size 1413 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_023010.3
RefSeq Size 2365 bp
RefSeq ORF 1413 bp
Locus ID 65109
UniProt ID Q9BZI7
Cytogenetics Xq24
Domains Smg4_UPF3
MW 56.2 kDa
Summary This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. The encoded protein is one of two functional homologs to yeast Upf3p. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. It forms with Y14 a complex that binds specifically 20 nt upstream of exon-exon junctions. This gene is located on the long arm of chromosome X. Two splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate coding segment, compared to variant 1, and encodes the shorter protein (isoform 2).
Write Your Own Review
You're reviewing:UPF3B (NM_023010) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221828 UPF3B (Myc-DDK-tagged)-Human UPF3 regulator of nonsense transcripts homolog B (yeast) (UPF3B), transcript variant 2 10 ug
$457.00
RC221828L3 Lenti ORF clone of Human UPF3 regulator of nonsense transcripts homolog B (yeast) (UPF3B), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC221828L4 Lenti ORF clone of Human UPF3 regulator of nonsense transcripts homolog B (yeast) (UPF3B), transcript variant 2, mGFP tagged 10 ug
$757.00
RG221828 UPF3B (tGFP-tagged) - Human UPF3 regulator of nonsense transcripts homolog B (yeast) (UPF3B), transcript variant 2 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.