QIL1 (C19orf70) (NM_205767) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | QIL1 |
Synonyms | C19orf70; MIC13; P117; QIL1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC309824 representing NM_205767.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTGGCCCGGGTGTGGTCGCTGATGAGGTTCCTCATCAAGGGAAGTGTGGCTGGGGGCGCCGTCTAC CTGGTGTACGACCAGGAGCTGCTGGGGCCCAGCGACAAGAGCCAGGCAGCCCTACAGAAGGCTGGGGAG GTGGTCCCCCCCGCCATGTACCAGTTCAGCCAGTACGTGTGTCAGCAGACAGGCCTGCAGATACCCCAG CTCCCAGCCCCTCCAAAGATTTACTTTCCCATCCGTGACTCCTGGAATGCAGGCATCATGACGGTGATG TCAGCTCTGTCGGTGGCCCCCTCCAAGGCCCGCGAGTACTCCAAGGAGGGCTGGGAGTATGTGAAGGCG CGCACCAAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_205767 |
Insert Size | 357 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_205767.2 |
RefSeq Size | 904 bp |
RefSeq ORF | 357 bp |
Locus ID | 125988 |
UniProt ID | Q5XKP0 |
Cytogenetics | 19p13.3 |
MW | 13.1 kDa |
Summary | Component of the MICOS complex, a large protein complex of the mitochondrial inner membrane that plays crucial roles in the maintenance of crista junctions, inner membrane architecture, and formation of contact sites to the outer membrane. Constituent of mature MICOS complex, it is required for the formation of cristae junction (CJ) and maintenance of cristae morphology. Required for the incorporation of MICOS10/MIC10 into the MICOS complex.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate 5' exon, which results in a difference in the 5' UTR and use of an alternate start codon compared to variant 1. It encodes isoform 2, which is shorter than and has a distinct N-terminus compared to isoform 1. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC202349 | C19orf70 (Myc-DDK-tagged)-Human chromosome 19 open reading frame 70 (C19orf70) | 10 ug |
$150.00
|
|
RC202349L3 | Lenti ORF clone of Human chromosome 19 open reading frame 70 (C19orf70), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC202349L4 | Lenti ORF clone of Human chromosome 19 open reading frame 70 (C19orf70), mGFP tagged | 10 ug |
$450.00
|
|
RG202349 | C19orf70 (tGFP-tagged) - Human chromosome 19 open reading frame 70 (C19orf70) | 10 ug |
$489.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.