Aurora A (AURKA) (NM_198437) Human Untagged Clone

SKU
SC309373
AURKA (untagged)-Human aurora kinase A (AURKA), transcript variant 6
$457.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Aurora A
Synonyms AIK; ARK1; AURA; BTAK; PPP1R47; STK6; STK7; STK15
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC309373 representing NM_198437.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACCGATCTAAAGAAAACTGCATTTCAGGACCTGTTAAGGCTACAGCTCCAGTTGGAGGTCCAAAA
CGTGTTCTCGTGACTCAGCAATTTCCTTGTCAGAATCCATTACCTGTAAATAGTGGCCAGGCTCAGCGG
GTCTTGTGTCCTTCAAATTCTTCCCAGCGCATTCCTTTGCAAGCACAAAAGCTTGTCTCCAGTCACAAG
CCGGTTCAGAATCAGAAGCAGAAGCAATTGCAGGCAACCAGTGTACCTCATCCTGTCTCCAGGCCACTG
AATAACACCCAAAAGAGCAAGCAGCCCCTGCCATCGGCACCTGAAAATAATCCTGAGGAGGAACTGGCA
TCAAAACAGAAAAATGAAGAATCAAAAAAGAGGCAGTGGGCTTTGGAAGACTTTGAAATTGGTCGCCCT
CTGGGTAAAGGAAAGTTTGGTAATGTTTATTTGGCAAGAGAAAAGCAAAGCAAGTTTATTCTGGCTCTT
AAAGTGTTATTTAAAGCTCAGCTGGAGAAAGCCGGAGTGGAGCATCAGCTCAGAAGAGAAGTAGAAATA
CAGTCCCACCTTCGGCATCCTAATATTCTTAGACTGTATGGTTATTTCCATGATGCTACCAGAGTCTAC
CTAATTCTGGAATATGCACCACTTGGAACAGTTTATAGAGAACTTCAGAAACTTTCAAAGTTTGATGAG
CAGAGAACTGCTACTTATATAACAGAATTGGCAAATGCCCTGTCTTACTGTCATTCGAAGAGAGTTATT
CATAGAGACATTAAGCCAGAGAACTTACTTCTTGGATCAGCTGGAGAGCTTAAAATTGCAGATTTTGGG
TGGTCAGTACATGCTCCATCTTCCAGGAGGACCACTCTCTGTGGCACCCTGGACTACCTGCCCCCTGAA
ATGATTGAAGGTCGGATGCATGATGAGAAGGTGGATCTCTGGAGCCTTGGAGTTCTTTGCTATGAATTT
TTAGTTGGGAAGCCTCCTTTTGAGGCAAACACATACCAAGAGACCTACAAAAGAATATCACGGGTTGAA
TTCACATTCCCTGACTTTGTAACAGAGGGAGCCAGGGACCTCATTTCAAGACTGTTGAAGCATAATCCC
AGCCAGAGGCCAATGCTCAGAGAAGTACTTGAACACCCCTGGATCACAGCAAATTCATCAAAACCATCA
AATTGCCAAAACAAAGAATCAGCTAGCAAACAGTCTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_198437
Insert Size 1212 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_198437.2
RefSeq Size 2172 bp
RefSeq ORF 1212 bp
Locus ID 6790
UniProt ID O14965
Cytogenetics 20q13.2
Protein Families Druggable Genome, Protein Kinase, Stem cell - Pluripotency
Protein Pathways Oocyte meiosis
MW 45.8 kDa
Summary The protein encoded by this gene is a cell cycle-regulated kinase that appears to be involved in microtubule formation and/or stabilization at the spindle pole during chromosome segregation. The encoded protein is found at the centrosome in interphase cells and at the spindle poles in mitosis. This gene may play a role in tumor development and progression. A processed pseudogene of this gene has been found on chromosome 1, and an unprocessed pseudogene has been found on chromosome 10. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (6) differs in the 5' UTR compared to variant 1. Variants 1-9 encode the same protein.
Write Your Own Review
You're reviewing:Aurora A (AURKA) (NM_198437) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202904 AURKA (Myc-DDK-tagged)-Human aurora kinase A (AURKA), transcript variant 6 10 ug
$457.00
RC202904L1 Lenti ORF clone of Human aurora kinase A (AURKA), transcript variant 6, Myc-DDK-tagged 10 ug
$757.00
RC202904L2 Lenti ORF clone of Human aurora kinase A (AURKA), transcript variant 6, mGFP tagged 10 ug
$757.00
RC202904L3 Lenti ORF clone of Human aurora kinase A (AURKA), transcript variant 6, Myc-DDK-tagged 10 ug
$757.00
RC202904L4 Lenti ORF clone of Human aurora kinase A (AURKA), transcript variant 6, mGFP tagged 10 ug
$757.00
RG202904 AURKA (tGFP-tagged) - Human aurora kinase A (AURKA), transcript variant 6 10 ug
$457.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.