FBXO36 (NM_174899) Human Untagged Clone

SKU
SC309212
FBXO36 (untagged)-Human F-box protein 36 (FBXO36)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FBXO36
Synonyms Fbx36
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC309212 representing NM_174899.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGTCGTGGCTGCCGGAGACTCTCTTTGAAACTGTAGGACAAGGCCCGCCGCCTAGCAAAGACTAT
TACCAGTTACTGGTCACCCGGTCTCAGGTAATCTTTAGATGGTGGAAGATCTCTCTAAGGAGTGAGTAT
CGATCAACAAAACCTGGAGAAGCAAAAGAAACCCATGAAGACTTCCTAGAGAATTCACATCTTCAAGGT
CAAACTGCCTTAATATTTGGTGCAAGAATATTAGACTATGTCATCAATTTGTGCAAAGGTAAATTTGAC
TTCCTTGAACGGCTCTCAGACGATTTGCTCCTGACTATCATTTCTTATCTGGATCTTGAAGATATTGCC
AGGCTTTGTCAAACATCACACAGATTTGCAAAGCTGTGCATGTCTGATAAACTGTGGGAACAGATAGTC
CAGTCGACCTGCGACACCATCACTCCTGACGTGAGGGCCCTGGCGGAGGACACAGGCTGGAGACAGCTG
TTCTTCACCAACAAGCTCCAGCTCCAGCGGCAGCTCCGCAAGAGGAAACAAAAATATGGAAACCTGAGA
GAAAAGCAACCTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_174899
Insert Size 567 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_174899.4
RefSeq Size 2832 bp
RefSeq ORF 567 bp
Locus ID 130888
UniProt ID Q8NEA4
Cytogenetics 2q36.3
Protein Families Druggable Genome
MW 22.1 kDa
Summary Members of the F-box protein family, such as FBXO36, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Write Your Own Review
You're reviewing:FBXO36 (NM_174899) Human Untagged Clone
Your Rating
SKU Description Size Price
RC222177 FBXO36 (Myc-DDK-tagged)-Human F-box protein 36 (FBXO36) 10 ug
$300.00
RC222177L1 Lenti ORF clone of Human F-box protein 36 (FBXO36), Myc-DDK-tagged 10 ug
$600.00
RC222177L2 Lenti ORF clone of Human F-box protein 36 (FBXO36), mGFP tagged 10 ug
$600.00
RC222177L3 Lenti ORF clone of Human F-box protein 36 (FBXO36), Myc-DDK-tagged 10 ug
$600.00
RC222177L4 Lenti ORF clone of Human F-box protein 36 (FBXO36), mGFP tagged 10 ug
$600.00
RG222177 FBXO36 (tGFP-tagged) - Human F-box protein 36 (FBXO36) 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.