SLC25A16 (NM_152707) Human Untagged Clone

SKU
SC309189
SLC25A16 (untagged)-Human solute carrier family 25 (mitochondrial carrier, Graves disease autoantigen), member 16 (SLC25A16), nuclear gene encoding mitochondrial protein
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SLC25A16
Synonyms D10S105E; GDA; GDC; HGT.1; hML7; ML7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC309189 representing NM_152707.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCGGCGACGGCCGCGGCAGCCCTGGCGGCGGCCGATCCCCCTCCCGCAATGCCGCAGGCGGCA
GGGGCCGGAGGGCCCACAACCCGCAGAGACTTCTACTGGCTGCGCTCCTTTCTGGCCGGAGGTATTGCT
GGATGCTGTGCCAAAACAACAGTTGCTCCATTGGATCGAGTAAAGGTTTTATTACAAGCTCACAATCAC
CATTACAAGCATTTAGGAGTATTTTCTGCATTGCGTGCTGTTCCTCAAAAAGAAGGATTCCTTGGATTG
TATAAAGGAAATGGTGCAATGATGATTCGAATCTTTCCCTATGGTGCAATCCAGTTTATGGCATTTGAG
CATTATAAAACGTTAATTACTACGAAGCTGGGAATTTCAGGTCATGTGCACAGATTAATGGCTGGATCC
ATGGCAGGTATGACAGCAGTTATCTGTACTTACCCTCTTGACATGGTTAGGGTCCGCCTAGCATTCCAG
GTGAAAGGGGAACACAGCTATACAGGAATTATTCATGCTTTCAAAACAATTTATGCAAAGGAAGGTGGT
TTCTTTGGATTTTACAGAGGTCTGATGCCTACTATTTTAGGAATGGCTCCATATGCAGGTGTTTCATTT
TTTACTTTTGGTACCTTGAAGAGTGTTGGGCTTTCCCATGCTCCTACCCTTCTTGGCAGACCTTCATCA
GACAATCCTAATGTCTTAGTTTTGAAAACTCATGTAAACTTACTTTGTGGTGGTGTTGCTGGAGCAATA
GCGCAGACAATATCCTACCCATTTGATGTGACTCGTCGGCGAATGCAATTAGGAACTGTTCTGCCGGAA
TTTGAAAAGTGCCTTACCATGCGGGATACTATGAAGTATGTCTATGGACACCATGGAATTCGAAAAGGA
CTCTATCGTGGTTTATCTCTTAATTACATTCGCTGTATTCCCTCTCAAGCAGTGGCTTTTACAACATAC
GAACTTATGAAGCAGTTTTTTCACCTCAACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_152707
Insert Size 999 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_152707.3
RefSeq Size 2264 bp
RefSeq ORF 999 bp
Locus ID 8034
UniProt ID P16260
Cytogenetics 10q21.3
Protein Families Druggable Genome
MW 36.2 kDa
Summary This gene encodes a protein that contains three tandemly repeated mitochondrial carrier protein domains. The encoded protein is localized in the inner membrane and facilitates the rapid transport and exchange of molecules between the cytosol and the mitochondrial matrix space. This gene has a possible role in Graves' disease. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:SLC25A16 (NM_152707) Human Untagged Clone
Your Rating
SKU Description Size Price
RC206966 SLC25A16 (Myc-DDK-tagged)-Human solute carrier family 25 (mitochondrial carrier, Graves disease autoantigen), member 16 (SLC25A16), nuclear gene encoding mitochondrial protein 10 ug
$300.00
RC206966L1 Lenti ORF clone of Human solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 (SLC25A16), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$600.00
RC206966L2 Lenti ORF clone of Human solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 (SLC25A16), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$600.00
RC206966L3 Lenti ORF clone of Human solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 (SLC25A16), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$600.00
RC206966L4 Lenti ORF clone of Human solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 (SLC25A16), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$600.00
RG206966 SLC25A16 (tGFP-tagged) - Human solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 (SLC25A16), nuclear gene encoding mitochondrial protein 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.