HSCB (NM_172002) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | HSCB |
Synonyms | DNAJC20; HSC20; JAC1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_172002 edited
GGCACGAGGTCTGGTTAGACGCTCTCTTTGCTTTTCCCCACGAGTGACCACGGCTAGATA GGCCGCCGGCCAGATGTGGCGGGGGAGAGCCGGGGCTTTGCTCCGGGTGTGGGGGTTTTG GCCGACAGGGGTTCCCAGAAGGAGACCGCTAAGCTGCGATGCTGCGTCGCAGGCGGGAAG CAATTATCCCCGCTGTTGGAACTGCGGCGGCCCATGGGGCCCCGGGCGGGAGGACAGGTT CTTCTGCCCACAGTGCCGAGCGCTGCAGGCACCTGACCCCACTCGAGACTACTTCAGCCT TATGGACTGCAACCGTTCCTTCAGAGTTGATACAGCGAAGCTCCAGCACAGGTACCAGCA ACTGCAGCGTCTTGTCCACCCAGATTTCTTCAGCCAGAGGTCTCAGACTGAAAAGGACTT CTCAGAGAAGCATTCGACCCTGGTGAATGATGCCTATAAGACCCTCCTGGCCCCCCTGAG CAGAGGACTGTACCTTCTAAAGCTCCATGGAATAGAGATTCCTGAAAGGACAGATTATGA AATGGACAGGCAATTCCTCATAGAAATAATGGAAATCAATGAAAAACTCGCAGAAGCTGA AAGTGAAGCTGCCATGAAAGAGATTGAATCCATTGTCAAAGCTAAACAGAAAGAATTTAC TGACAATGTGAGCAGTGCTTTTGAACAAGATGACTTTGAAGAAGCCAAGGAAATTTTGAC AAAGATGAGATACTTTTCAAATATAGAAGAAAAGATCAAGTTAAAGAAGATTCCCCTTTA ATTGTGGATAGTTTAAAGTTTAAAAAATAAAGTTCTTGCTGGGCACAGTGGCTCACACCT GTAATCCCAGCACTTTGGGAGGCTGAGGTGGGTGGATGACAAGGTCAGGAGTTCAAGACC AGCTTGGCCAACATAGTGAAACCCCGTCTCTGCTGAAAATACAAAAATTAGCCGGGCATG GTGGCGCGTGCCTGTAATCCCAGCTACTTGGTAGGCCGAGGCAGGAGAATCGCTTAAACC CGTGAGGTGGAGGTTGCAGTGAGCAGAGATCACGCAACTGCACTCCAGCTTGGGCAACAG AGTGAGACTTAATCTTGAAAAATAAATAAATGAAAAATAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_172002 |
Insert Size | 1100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_172002.3. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_172002.3, NP_741999.3 |
RefSeq Size | 1106 bp |
RefSeq ORF | 708 bp |
Locus ID | 150274 |
UniProt ID | Q8IWL3 |
Cytogenetics | 22q12.1 |
Summary | This gene encodes a DnaJ-type co-chaperone and member of the heat shock cognate B (HscB) family of proteins. The encoded protein plays a role in the synthesis of iron-sulfur clusters, protein cofactors that are involved in the redox reactions of mitochondrial electron transport and other processes. Cells in which this gene is knocked down exhibit reduced activity of iron-sulfur cluster-dependent enzymes including succinate dehydrogenase and aconitase. The encoded protein may stimulate the ATPase activity of the mitochondrial stress-70 protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC200843 | HSCB (Myc-DDK-tagged)-Human HscB iron-sulfur cluster co-chaperone homolog (E. coli) (HSCB) | 10 ug |
$300.00
|
|
RC200843L1 | Lenti ORF clone of Human HscB iron-sulfur cluster co-chaperone homolog (E. coli) (HSCB), Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC200843L2 | Lenti ORF clone of Human HscB iron-sulfur cluster co-chaperone homolog (E. coli) (HSCB), mGFP tagged | 10 ug |
$600.00
|
|
RC200843L3 | Lenti ORF clone of Human HscB iron-sulfur cluster co-chaperone homolog (E. coli) (HSCB), Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC200843L4 | Lenti ORF clone of Human HscB iron-sulfur cluster co-chaperone homolog (E. coli) (HSCB), mGFP tagged | 10 ug |
$600.00
|
|
RG200843 | HSCB (tGFP-tagged) - Human HscB iron-sulfur cluster co-chaperone homolog (E. coli) (HSCB) | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.