HSCB (NM_172002) Human Untagged Clone

SKU
SC309178
HSCB (untagged)-Human HscB iron-sulfur cluster co-chaperone homolog (E. coli) (HSCB)
$300.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HSCB
Synonyms DNAJC20; HSC20; JAC1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_172002 edited
GGCACGAGGTCTGGTTAGACGCTCTCTTTGCTTTTCCCCACGAGTGACCACGGCTAGATA
GGCCGCCGGCCAGATGTGGCGGGGGAGAGCCGGGGCTTTGCTCCGGGTGTGGGGGTTTTG
GCCGACAGGGGTTCCCAGAAGGAGACCGCTAAGCTGCGATGCTGCGTCGCAGGCGGGAAG
CAATTATCCCCGCTGTTGGAACTGCGGCGGCCCATGGGGCCCCGGGCGGGAGGACAGGTT
CTTCTGCCCACAGTGCCGAGCGCTGCAGGCACCTGACCCCACTCGAGACTACTTCAGCCT
TATGGACTGCAACCGTTCCTTCAGAGTTGATACAGCGAAGCTCCAGCACAGGTACCAGCA
ACTGCAGCGTCTTGTCCACCCAGATTTCTTCAGCCAGAGGTCTCAGACTGAAAAGGACTT
CTCAGAGAAGCATTCGACCCTGGTGAATGATGCCTATAAGACCCTCCTGGCCCCCCTGAG
CAGAGGACTGTACCTTCTAAAGCTCCATGGAATAGAGATTCCTGAAAGGACAGATTATGA
AATGGACAGGCAATTCCTCATAGAAATAATGGAAATCAATGAAAAACTCGCAGAAGCTGA
AAGTGAAGCTGCCATGAAAGAGATTGAATCCATTGTCAAAGCTAAACAGAAAGAATTTAC
TGACAATGTGAGCAGTGCTTTTGAACAAGATGACTTTGAAGAAGCCAAGGAAATTTTGAC
AAAGATGAGATACTTTTCAAATATAGAAGAAAAGATCAAGTTAAAGAAGATTCCCCTTTA
ATTGTGGATAGTTTAAAGTTTAAAAAATAAAGTTCTTGCTGGGCACAGTGGCTCACACCT
GTAATCCCAGCACTTTGGGAGGCTGAGGTGGGTGGATGACAAGGTCAGGAGTTCAAGACC
AGCTTGGCCAACATAGTGAAACCCCGTCTCTGCTGAAAATACAAAAATTAGCCGGGCATG
GTGGCGCGTGCCTGTAATCCCAGCTACTTGGTAGGCCGAGGCAGGAGAATCGCTTAAACC
CGTGAGGTGGAGGTTGCAGTGAGCAGAGATCACGCAACTGCACTCCAGCTTGGGCAACAG
AGTGAGACTTAATCTTGAAAAATAAATAAATGAAAAATAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_172002
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_172002.3.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_172002.3, NP_741999.3
RefSeq Size 1106 bp
RefSeq ORF 708 bp
Locus ID 150274
UniProt ID Q8IWL3
Cytogenetics 22q12.1
Summary This gene encodes a DnaJ-type co-chaperone and member of the heat shock cognate B (HscB) family of proteins. The encoded protein plays a role in the synthesis of iron-sulfur clusters, protein cofactors that are involved in the redox reactions of mitochondrial electron transport and other processes. Cells in which this gene is knocked down exhibit reduced activity of iron-sulfur cluster-dependent enzymes including succinate dehydrogenase and aconitase. The encoded protein may stimulate the ATPase activity of the mitochondrial stress-70 protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
Write Your Own Review
You're reviewing:HSCB (NM_172002) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200843 HSCB (Myc-DDK-tagged)-Human HscB iron-sulfur cluster co-chaperone homolog (E. coli) (HSCB) 10 ug
$300.00
RC200843L1 Lenti ORF clone of Human HscB iron-sulfur cluster co-chaperone homolog (E. coli) (HSCB), Myc-DDK-tagged 10 ug
$600.00
RC200843L2 Lenti ORF clone of Human HscB iron-sulfur cluster co-chaperone homolog (E. coli) (HSCB), mGFP tagged 10 ug
$600.00
RC200843L3 Lenti ORF clone of Human HscB iron-sulfur cluster co-chaperone homolog (E. coli) (HSCB), Myc-DDK-tagged 10 ug
$600.00
RC200843L4 Lenti ORF clone of Human HscB iron-sulfur cluster co-chaperone homolog (E. coli) (HSCB), mGFP tagged 10 ug
$600.00
RG200843 HSCB (tGFP-tagged) - Human HscB iron-sulfur cluster co-chaperone homolog (E. coli) (HSCB) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.