LARP6 (NM_197958) Human Untagged Clone

SKU SC307619

LARP6 (untagged)-Human La ribonucleoprotein domain family, member 6 (LARP6), transcript variant 2

Product Data

• Type: Human Untagged Clone
• Target Symbol: LARP6
• Synonyms: ACHN
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC307619 representing NM_197958.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGGCCCAGTCCGGCGGGGAGGCTCGGCCCGGGCCCAAGACGGCGGTGCAGATCCGCGTCGCCATCCAG; GAGGCCGAGGACGTGGACGAGTTGGAGGACGAGGAGGAGGGGGCGGAGACTCGGGGCGCCGGGGACCCG; GCCCGGTACCTCAGCCCCGGCTGGGGCAGCGCGAGCGAGGAGGAGCCGAGCCGCGGGCACAGGAATAGG; AGCTCGGTGAATTCAAGGACCATGCTTGCTTCGTTCATTGTATCTTCAGCACCTAGCACAGCACCCAGC; ACATAG; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_197958
• Insert Size: 282 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_197958.2
• RefSeq Size: 683 bp
• RefSeq ORF: 282 bp
• Locus ID: 55323
• UniProt ID: Q9BRS8
• Cytogenetics: 15q23
• MW: 9.8 kDa
• Summary: Regulates the coordinated translation of type I collagen alpha-1 and alpha-2 mRNAs, CO1A1 and CO1A2. Stabilizes mRNAs through high-affinity binding of a stem-loop structure in their 5' UTR. This regulation requires VIM and MYH10 filaments, and the helicase DHX9.[UniProtKB/Swiss-Prot Function]; Transcript Variant: This variant (2) lacks several exons and uses an alternate 3' terminal exon, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1.