LASS3 (CERS3) (NM_178842) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | LASS3 |
Synonyms | ARCI9; LASS3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC307230 representing NM_178842.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTTTGGACGTTTAAAGAATGGTTCTGGTTGGAAAGATTCTGGCTTCCTCCAACAATAAAGTGGTCA GATCTTGAGGATCACGATGGACTCGTCTTTGTAAAACCTTCTCATTTATACGTGACAATTCCATATGCT TTTCTCTTGCTGATTATCAGACGTGTATTTGAAAAATTTGTTGCTTCACCTCTAGCAAAATCATTTGGC ATTAAAGAGACAGTTCGAAAGGTTACACCAAATACTGTCTTAGAGAATTTTTTCAAACATTCCACAAGG CAACCATTGCAAACTGATATTTATGGACTGGCAAAGAAGTGTAACTTGACGGAGCGCCAGGTGGAAAGA TGGTTTAGGAGTCGGCGGAATCAAGAGAGGCCTTCCAGGCTGAAGAAATTCCAGGAAGCTTGCTGGAGA TTTGCATTTTACTTAATGATCACTGTTGCTGGAATTGCGTTTCTTTATGATAAACCTTGGCTATATGAC TTATGGGAGGTTTGGAATGGCTATCCCAAACAGCCCCTGCTGCCATCCCAGTACTGGTACTACATTTTA GAAATGAGTTTTTATTGGTCTCTGTTATTTAGACTTGGCTTTGATGTCAAGAGAAAGGATTTTCTAGCT CATATCATCCACCACCTGGCTGCTATTAGTCTGATGAGCTTCTCTTGGTGTGCTAATTATATTCGCAGT GGGACCCTCGTGATGATTGTACACGATGTGGCTGACATTTGGCTGGAGTCTGCTAAGATGTTTTCTTAT GCTGGATGGACGCAGACCTGTAACACCCTGTTTTTCATCTTCTCCACCATATTTTTCATCAGCCGCCTC ATTGTTTTTCCTTTCTGGATTTTATATTGCACGCTGATCTTGCCTATGTATCACCTCGAGCCTTTCTTT TCATACATCTTCCTCAACCTACAGCTCATGATCTTGCAGGTCCTTCACCTTTACTGGGGTTATTACATC TTGAAGATGCTCAACAGATGTATATTCATGAAGAGCATCCAGGATGTGAGGAGTGATGACGAGGATTAT GAAGAGGAAGAGGAAGAGGAAGAAGAAGAGGCTACCAAAGGCAAAGAGATGGATTGTTTAAAGAACGGC CTCAGGGCTGAGAGGCACCTCATTCCCAATGGCCAGCATGGCCATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_178842 |
Insert Size | 1152 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_178842.4 |
RefSeq Size | 3909 bp |
RefSeq ORF | 1152 bp |
Locus ID | 204219 |
UniProt ID | Q8IU89 |
Cytogenetics | 15q26.3 |
Protein Families | Transcription Factors, Transmembrane |
MW | 46.3 kDa |
Summary | This gene is a member of the ceramide synthase family of genes. The ceramide synthase enzymes regulate sphingolipid synthesis by catalyzing the formation of ceramides from sphingoid base and acyl-coA substrates. This family member is involved in the synthesis of ceramides with ultra-long-chain acyl moieties (ULC-Cers), important to the epidermis in its role in creating a protective barrier from the environment. The protein encoded by this gene has also been implicated in modification of the lipid structures required for spermatogenesis. Mutations in this gene have been associated with male fertility defects, and epidermal defects, including ichthyosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015] Transcript Variant: This variant (4) differs in the 5' UTR and the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. Variants 2, 3 and 4 encode the same isoform (2), which has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC205511 | CERS3 (Myc-DDK-tagged)-Human LAG1 homolog, ceramide synthase 3 (LASS3) | 10 ug |
$457.00
|
|
RC205511L1 | Lenti ORF clone of Human LAG1 homolog, ceramide synthase 3 (LASS3), Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC205511L2 | Lenti ORF clone of Human LAG1 homolog, ceramide synthase 3 (LASS3), mGFP tagged | 10 ug |
$757.00
|
|
RC205511L3 | Lenti ORF clone of Human LAG1 homolog, ceramide synthase 3 (LASS3), Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC205511L4 | Lenti ORF clone of Human LAG1 homolog, ceramide synthase 3 (LASS3), mGFP tagged | 10 ug |
$757.00
|
|
RG205511 | CERS3 (tGFP-tagged) - Human LAG1 homolog, ceramide synthase 3 (LASS3) | 10 ug |
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.