GGTLC1 (NM_178311) Human Untagged Clone

SKU
SC307148
GGTLC1 (untagged)-Human gamma-glutamyltransferase light chain 1 (GGTLC1), transcript variant A
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GGTLC1
Synonyms dJ831C21.1; dJ831C21.2; GGTL6; GGTLA3; GGTLA4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307148 representing NM_178311.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCTCCGAGTTCTTCTCTGCCCAGCTCCGGGCCCAGATCTCTGACGACACCACTCACCCGATCTCC
TACTACAAGCCCGAGTTCTACATGCCGGATGACGGGGGCACTGCTCACCTGTCTGTGGTCGCAGAGGAC
GGCAGTGCTGTGTCCGCCACCAGCACCATCAACCTCTACTTTGGCTCCAAGGTGCGCTCCCCAGTCAGC
GGGATCCTGCTCAATAATGAAATGGATGACTTCAGCTCTACCAGCATCACCAACGAGTTTGGGGTACCC
CCCTCACCTGCCAATTTCATCCAGCCAGGGAAGCAGCCGCTCTCGTCCATGTGCCCGACGATCATGGTG
GGCCAGGACGGCCAGGTCCGGATGGTGGTGGGAGCTGCCGGGGGCACGCAGATCACCATGGCCACTGCA
CTGGCCATCATCTACAACCTCTGGTTCGGCTATGACGTGAAGTGGGCCGTGGAGGAGCCCCGGCTGCAC
AACCAGCTTCTGCCCAACGTCACGACAGTGGAGAGAAACATTGACCAGGAAGTGACTGCAGCCCTGGAG
ACCCGGCACCATCACACCCAGATCACGTCCACCTTCATTGCTGTGGTGCAAGCCATCGTCCGCATGGCT
GGTGGCTGGGCAGCTGCCTCGGACTCCAGGAAAGGTGGGGAACCTGCTGGCTACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_178311
Insert Size 678 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_178311.2
RefSeq Size 1066 bp
RefSeq ORF 678 bp
Locus ID 92086
UniProt ID Q9BX51
Cytogenetics 20p11.21
MW 24.3 kDa
Summary This gene encodes a member of the gamma-glutamyl transpeptidase (GGT) family, which are important in the metabolism of glutathione. The most ubiquitously expressed human GGT gene, GGT1, encodes a single transmembrane polypeptide that is post-translationally processed to form a heavy and a light chain. In contrast, the product of this gene only contains homology to the light chain region, and lacks a transmembrane domain. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (A) represents the longer transcript. Both variants A and B encode the same protein.
Write Your Own Review
You're reviewing:GGTLC1 (NM_178311) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212634 GGTLC1 (Myc-DDK-tagged)-Human gamma-glutamyltransferase light chain 1 (GGTLC1), transcript variant A 10 ug
$300.00
RC212634L1 Lenti ORF clone of Human gamma-glutamyltransferase light chain 1 (GGTLC1), transcript variant A, Myc-DDK-tagged 10 ug
$600.00
RC212634L2 Lenti ORF clone of Human gamma-glutamyltransferase light chain 1 (GGTLC1), transcript variant A, mGFP tagged 10 ug
$600.00
RC212634L3 Lenti ORF clone of Human gamma-glutamyltransferase light chain 1 (GGTLC1), transcript variant A, Myc-DDK-tagged 10 ug
$600.00
RC212634L4 Lenti ORF clone of Human gamma-glutamyltransferase light chain 1 (GGTLC1), transcript variant A, mGFP tagged 10 ug
$600.00
RG212634 GGTLC1 (tGFP-tagged) - Human gamma-glutamyltransferase light chain 1 (GGTLC1), transcript variant A 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.