GPLD1 (NM_177483) Human Untagged Clone

SKU
SC307100
GPLD1 (untagged)-Human glycosylphosphatidylinositol specific phospholipase D1 (GPLD1), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GPLD1
Synonyms GPIPLD; GPIPLDM; MGC22590; PIGPLD; PIGPLD1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307100 representing NM_177483.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTGCTTTCAGGTTGTGGCCTGGCCTGCTGATCATGTTGGGTTCTCTCTGCCATAGAGGTTCACCG
TGTGGCCTTTCAACACACGTAGAAATAGGACACAGAGCTCTGGAGTTTCTTCAGCTTCACAATGGGCGT
GTTAACTACAGAGAGCTGTTACTAGAACACCAGGATGCGTATCAGGCTGGAATCGTGTTTCCTGATTGT
TTTTACCCTAGCATCTGCAAAGGAGGAAAATTCCATGATGTGTCTGAGAGCACTCACTGGACTCCGTTT
CTTAATGCAAGCGTTCATTATATCCGAGAGAACTATCCCCTTCCCTGGGAGAAGGACACAGAGAAACTG
GTAGCTTTCTTGTTTGGAATTACTTCTCACATGGCGGCAGATGTCAGCTGGCATAGTCTGGGCCTTGAA
CAAGGATTCCTTAGGACCATGGGAGCTATTGATTTTCACGGCTCCTATTCAGAGGCTCATTCGGCTGGT
GATTTTGGTACTGTTTATTTACATTTGCTAAATTTTCTCGTGGTATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_177483
Insert Size 531 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_177483.1
RefSeq Size 1096 bp
RefSeq ORF 531 bp
Locus ID 2822
Cytogenetics 6p22.3
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Glycosylphosphatidylinositol(GPI)-anchor biosynthesis
MW 19.9 kDa
Summary Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR and uses an alternate splice site in the 3' coding region, compared to variant 1. This results in a protein (isoform 2) with a shorter C-terminus, compared to isoform 1.
Write Your Own Review
You're reviewing:GPLD1 (NM_177483) Human Untagged Clone
Your Rating
SKU Description Size Price
RC223455 GPLD1 (Myc-DDK-tagged)-Human glycosylphosphatidylinositol specific phospholipase D1 (GPLD1), transcript variant 2 10 ug
$300.00
RC223455L1 Lenti ORF clone of Human glycosylphosphatidylinositol specific phospholipase D1 (GPLD1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC223455L2 Lenti ORF clone of Human glycosylphosphatidylinositol specific phospholipase D1 (GPLD1), transcript variant 2, mGFP tagged 10 ug
$600.00
RC223455L3 Lenti ORF clone of Human glycosylphosphatidylinositol specific phospholipase D1 (GPLD1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC223455L4 Lenti ORF clone of Human glycosylphosphatidylinositol specific phospholipase D1 (GPLD1), transcript variant 2, mGFP tagged 10 ug
$600.00
RG223455 GPLD1 (tGFP-tagged) - Human glycosylphosphatidylinositol specific phospholipase D1 (GPLD1), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.