NICE2 (S100A7A) (NM_176823) Human Untagged Clone

SKU
SC307072
S100A7A (untagged)-Human S100 calcium binding protein A7A (S100A7A)
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NICE2
Synonyms NICE-2; NICE2; S100A7f; S100A7L1; S100A15
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_176823, the custom clone sequence may differ by one or more nucleotides


ATGAGCAACACTCAAGCTGAGAGGTCCATAATAGGCATGATCGACATGTTTCACAAATACACCGGACGTG
ATGGCAAGATTGAGAAGCCAAGCCTGCTGACGATGATGAAGGAGAACTTCCCCAATTTCCTCAGTGCCTG
TGACAAAAAGGGCATACATTACCTCGCCACTGTCTTTGAGAAAAAGGACAAGAATGAGGATAAGAAGATT
GATTTTTCTGAGTTTCTGTCCTTGCTGGGAGACATAGCCGCAGACTACCACAAGCAGAGCCATGGAGCGG
CGCCCTGTTCTGGGGGAAGCCAGTGA


Restriction Sites Please inquire
ACCN NM_176823
Insert Size 300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_176823.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_176823.2, NP_789793.1
RefSeq Size 4351 bp
RefSeq ORF 306 bp
Locus ID 338324
UniProt ID Q86SG5
Cytogenetics 1q21.3
Summary May be involved in epidermal differentiation and inflammation and might therefore be important for the pathogenesis of psoriasis and other diseases.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:NICE2 (S100A7A) (NM_176823) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221177 S100A7A (Myc-DDK-tagged)-Human S100 calcium binding protein A7A (S100A7A) 10 ug
$150.00
RC221177L1 Lenti ORF clone of Human S100 calcium binding protein A7A (S100A7A), Myc-DDK-tagged 10 ug
$450.00
RC221177L2 Lenti ORF clone of Human S100 calcium binding protein A7A (S100A7A), mGFP tagged 10 ug
$450.00
RC221177L3 Lenti ORF clone of Human S100 calcium binding protein A7A (S100A7A), Myc-DDK-tagged 10 ug
$450.00
RC221177L4 Lenti ORF clone of Human S100 calcium binding protein A7A (S100A7A), mGFP tagged 10 ug
$450.00
RG221177 S100A7A (tGFP-tagged) - Human S100 calcium binding protein A7A (S100A7A) 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.