DYNLRB2 (NM_130897) Human Untagged Clone

SKU
SC305925
DYNLRB2 (untagged)-Human dynein, light chain, roadblock-type 2 (DYNLRB2)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DYNLRB2
Synonyms DNCL2B; DNLC2B; ROBLD2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC305925 representing NM_130897.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGAGGTGGAGGAAACCTTAAAGAGGATCCAGAGTCATAAAGGGGTTATTGGAACTATGGTTGTA
AATGCAGAAGGTATTCCCATCCGAACAACCTTGGACAACTCAACAACTGTTCAATATGCAGGCCTTCTT
CATCACCTGACAATGAAAGCCAAAAGCACAGTTCGTGATATTGATCCTCAGAACGACCTGACTTTTCTT
AGGATCAGATCAAAGAAACATGAAATCATGGTAGCTCCAGATAAGGAATATCTTCTGATCGTCATTCAG
AATCCATGTGAATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_130897
Insert Size 291 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_130897.2
RefSeq Size 667 bp
RefSeq ORF 291 bp
Locus ID 83657
UniProt ID Q8TF09
Cytogenetics 16q23.2
MW 10.9 kDa
Summary Acts as one of several non-catalytic accessory components of the cytoplasmic dynein 1 complex that are thought to be involved in linking dynein to cargos and to adapter proteins that regulate dynein function. Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the shorter isoform (1).
Write Your Own Review
You're reviewing:DYNLRB2 (NM_130897) Human Untagged Clone
Your Rating
SKU Description Size Price
RC219143 DYNLRB2 (Myc-DDK-tagged)-Human dynein, light chain, roadblock-type 2 (DYNLRB2) 10 ug
$150.00
RC219143L3 Lenti ORF clone of Human dynein, light chain, roadblock-type 2 (DYNLRB2), Myc-DDK-tagged 10 ug
$450.00
RC219143L4 Lenti ORF clone of Human dynein, light chain, roadblock-type 2 (DYNLRB2), mGFP tagged 10 ug
$450.00
RG219143 DYNLRB2 (tGFP-tagged) - Human dynein, light chain, roadblock-type 2 (DYNLRB2) 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.