C20orf70 (BPIFA2) (NM_080574) Human Untagged Clone

SKU
SC305797
BPIFA2 (untagged)-Human chromosome 20 open reading frame 70 (C20orf70)
$300.00
5 Days*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C20orf70
Synonyms bA49G10.1; C20orf70; PSP; SPLUNC2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_080574 edited
GGGGATCCCAGCAGACTGTGCAGTGGGGCAAGGATTTCATGAGCATCCTCCTCTAAACGC
GTGTCAAGACAAAAGATGCTTCAGCTTTGGAAACTTGTTCTCCTGTGCGGCGTGCTCACT
GGGACCTCAGAGTCTCTTCTTGACAATCTTGGCAATGACCTAAGCAATGTCGTGGATAAG
CTGGAACCTGTTCTTCACGAGGGACTTGAGACAGTTGACAATACTCTTAAAGGCATCCTT
GAGAAACTGAAGGTCGACCTAGGAGTGCTTCAGAAATCCAGTGCTTGGCAACTGGCCAAG
CAGAAGGCCCAGGAAGCTGAGAAATTGCTGAACAATGTCATTTCTAAGCTGCTTCCAACT
AACACGGACATTTTTGGGTTGAAAATCAGCAACTCCCTCATCCTGGATGTCAAAGCTGAA
CCGATCGATGATGGCAAAGGCCTTAACCTGAGCTTCCCTGTCACCGCGAATGTCACTGTG
GCCGGGCCCATCATTGGCCAGATTATCAACCTGAAAGCCTCCTTGGACCTCCTGACCGCA
GTCACAATTGAAACTGATCCCCAGACACACCAGCCTGTTGCCGTCCTGGGAGAATGCGCC
AGTGACCCAACCAGCATCTCACTTTCCTTGCTGGACAAACACAGCCAAATCATCAACAAG
TTCGTGAATAGCGTGATCAACACGCTGAAAAGCACTGTATCCTCCCTGCTGCAGAAGGAG
ATATGTCCACTGATCCGCATCTTCATCCACTCCCTGGATGTGAATGTCATTCAGCAGGTC
GTCGATAATCCTCAGCACAAAACCCAGCTGCAAACCCTCATCTGAAGAGGACGAATGAGG
AGGACCACTGTGGTGCATGCTGATTGGTTCCCAGTGGCTTGCCCCACCCCCTTATAGCAT
CTCCCTCCAGGAAGCTGCTGCCACCACCTAACCAGCGTGAAAGCCTGAGTCCCACCAGAA
GGACCTTCCCAGATACCCCTTCTCCTCACAGTCAGAACAGCAGCCTCTACACATGTTGTC
CTGCCCCTGGCAATAAAGGCCCATTTCTGCAAAAAAGAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAA
Restriction Sites Please inquire
ACCN NM_080574
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_080574.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_080574.2, NP_542141.1
RefSeq Size 1054 bp
RefSeq ORF 750 bp
Locus ID 140683
UniProt ID Q96DR5
Cytogenetics 20q11.21
Protein Families Secreted Protein
Summary This gene encodes a member of the palate, lung and nasal epithelium clone (Plunc) family of proteins. Members of this family have been proposed to play a role in the local antibacterial response in nose, mouth and upper respiratory pathways. The encoded soluble salivary protein binds bacterial lipopolysaccharide (LPS) and inhibits bacterial growth. This gene is present in a gene cluster on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.
Write Your Own Review
You're reviewing:C20orf70 (BPIFA2) (NM_080574) Human Untagged Clone
Your Rating
SKU Description Size Price
RC209376 BPIFA2 (Myc-DDK-tagged)-Human chromosome 20 open reading frame 70 (C20orf70) 10 ug
$300.00
RC209376L1 Lenti ORF clone of Human chromosome 20 open reading frame 70 (C20orf70), Myc-DDK-tagged 10 ug
$600.00
RC209376L2 Lenti ORF clone of Human chromosome 20 open reading frame 70 (C20orf70), mGFP tagged 10 ug
$600.00
RC209376L3 Lenti ORF clone of Human chromosome 20 open reading frame 70 (C20orf70), Myc-DDK-tagged 10 ug
$600.00
RC209376L4 Lenti ORF clone of Human chromosome 20 open reading frame 70 (C20orf70), mGFP tagged 10 ug
$600.00
RG209376 BPIFA2 (tGFP-tagged) - Human chromosome 20 open reading frame 70 (C20orf70) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.