Ovary specific acidic protein (MGARP) (NM_032623) Human Untagged Clone

SKU
SC305491
MGARP (untagged)-Human chromosome 4 open reading frame 49 (C4orf49)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Ovary specific acidic protein
Synonyms C4orf49; CESP-1; HUMMR; OSAP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC305491 representing NM_032623.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTATCTCCGCAGGGCGGTCTCCAAGACTCTGGCGCTGCCGCTGAGGGCGCCCCCCAACCCCGCGCCG
CTCGGAAAGGACGCATCTCTGCGCCGGATGTCATCTAACAGATTCCCTGGATCATCTGGATCAAATATG
ATTTATTATCTGGTTGTAGGCGTCACAGTCAGTGCTGGTGGATATTATGCTTACAAGACAGTCACATCA
GACCAAGCCAAACACACAGAACATAAAACAAATTTGAAAGAAAAAACAAAAGCAGAGATACATCCATTT
CAAGGTGAAAAGGAGAATGTTGCGGAAACTGAGAAAGCAAGTTCAGAAGCCCCAGAAGAACTTATAGTG
GAAGCTGAGGTGGTAGATGCTGAAGAAAGTCCCAGTGCTACAGTTGTGGTCATAAAAGAGGCATCTGCC
TGTCCAGGTCACGTGGAGGCTGCTCCGGAGACCACAGCAGTCAGTGCTGAAACCGGGCCAGAGGTCACA
GATGCAGCGGCGAGGGAAACCACGGAAGTAAACCCTGAAACAACCCCAGAGGTTACAAATGCTGCCCTG
GATGAAGCTGTCACCATCGATAATGATAAAGATACAACAAAGAACGAAACCTCTGATGAATATGCTGAA
CTAGAAGAAGAAAATTCTCCAGCTGAGTCAGAGTCCTCTGCTGGAGATGATTTACAGGAGGAAGCCAGT
GTTGGCTCTGAGGCTGCTTCGGCTCAAGGCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_032623
Insert Size 723 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_032623.3
RefSeq Size 1339 bp
RefSeq ORF 723 bp
Locus ID 84709
UniProt ID Q8TDB4
Cytogenetics 4q31.1
Protein Families Transmembrane
MW 25.4 kDa
Summary Plays a role in the trafficking of mitochondria along microtubules. Regulates the kinesin-mediated axonal transport of mitochondria to nerve terminals along microtubules during hypoxia. Participates in the translocation of TRAK2/GRIF1 from the cytoplasm to the mitochondrion. Also plays a role in steroidogenesis through maintenance of mitochondrial abundance and morphology (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Ovary specific acidic protein (MGARP) (NM_032623) Human Untagged Clone
Your Rating
SKU Description Size Price
RC216908 MGARP (Myc-DDK-tagged)-Human chromosome 4 open reading frame 49 (C4orf49) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RC216908L1 Lenti-ORF clone of MGARP (Myc-DDK-tagged)-Human chromosome 4 open reading frame 49 (C4orf49) 10 ug
$600.00
RC216908L2 Lenti-ORF clone of MGARP (mGFP-tagged)-Human chromosome 4 open reading frame 49 (C4orf49) 10 ug
$600.00
RC216908L3 Lenti-ORF clone of MGARP (Myc-DDK-tagged)-Human chromosome 4 open reading frame 49 (C4orf49) 10 ug
$600.00
RC216908L4 Lenti-ORF clone of MGARP (mGFP-tagged)-Human chromosome 4 open reading frame 49 (C4orf49) 10 ug
$600.00
RG216908 MGARP (tGFP-tagged) - Human chromosome 4 open reading frame 49 (C4orf49) 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.