RNF122 (NM_024787) Human Untagged Clone

SKU
SC305152
RNF122 (untagged)-Human ring finger protein 122 (RNF122)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RNF122
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC305152 representing NM_024787.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCACCCATTCCAGTGGTGTAACGGGTGTTTCTGTGGCCTGGGACTGGTTAGCACCAACAAGTCCTGC
TCGATGCCACCCATCAGTTTCCAGGACCTTCCGCTCAACATCTATATGGTCATCTTCGGCACAGGCATC
TTTGTCTTCATGCTCAGCCTTATCTTCTGCTGCTATTTTATCAGCAAACTGCGGAACCAGGCACAGAGT
GAGCGATACGGATATAAGGAGGTGGTGCTTAAAGGTGATGCCAAGAAGTTACAATTATATGGGCAGACC
TGCGCAGTCTGTCTGGAAGACTTCAAGGGGAAGGATGAGTTAGGCGTGCTCCCGTGCCAACACGCCTTT
CACCGCAAGTGTCTGGTGAAATGGCTGGAAGTTCGCTGTGTCTGCCCCATGTGTAACAAGCCCATTGCT
AGTCCCTCAGAGGCCACGCAGAACATTGGGATTCTATTGGATGAGCTGGTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_024787
Insert Size 468 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024787.3
RefSeq Size 1872 bp
RefSeq ORF 468 bp
Locus ID 79845
UniProt ID Q9H9V4
Cytogenetics 8p12
Protein Families Druggable Genome, Transmembrane
MW 17.5 kDa
Summary The encoded protein contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. The encoded protein is localized to the endoplasmic reticulum and golgi apparatus, and may be associated with cell viability. [provided by RefSeq, Jul 2013]
Write Your Own Review
You're reviewing:RNF122 (NM_024787) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210868 RNF122 (Myc-DDK-tagged)-Human ring finger protein 122 (RNF122) 10 ug
$150.00
RC210868L3 Lenti ORF clone of Human ring finger protein 122 (RNF122), Myc-DDK-tagged 10 ug
$450.00
RC210868L4 Lenti ORF clone of Human ring finger protein 122 (RNF122), mGFP tagged 10 ug
$450.00
RG210868 RNF122 (tGFP-tagged) - Human ring finger protein 122 (RNF122) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.