C1orf135 (AUNIP) (NM_024037) Human Untagged Clone

SKU
SC305093
AUNIP (untagged)-Human chromosome 1 open reading frame 135 (C1orf135)
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C1orf135
Synonyms AIBP; C1orf135
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC305093 representing NM_024037.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGGCGGACAGGCCCCGAGGAGGAGGCCTGCGGCGTGTGGCTGGACGCGGCGGCGCTGAAGAGGCGG
AAAGTGCAGACACATTTAATCAAACCAGGCACCAAAATGCTAACACTCCTTCCTGGAGAAAGAAAGGCT
AATATTTATTTTACTCAAAGAAGAGCTCCATCTACAGGCATTCACCAGAGAAGCATTGCTTCCTTCTTC
ACCTTGCAGCCAGGAAAGACAAATGGCAGTGACCAGAAGAGTGTTTCATCTCATACAGAAAGTCAGATC
AACAAAGAGTCCAAGAAAAATGCGACCCAGCTAGACCATTTGATCCCAGGCTTAGCACACGATTGCATG
GCATCCCCTTTAGCCACTTCAACCACTGCAGACATCCAGGAAGCTGGACTCTCTCCTCAGTCCCTCCAG
ACTTCTGGCCACCACAGAATGAAAACCCCATTTTCAACTGAGCTATCTTTGCTCCAGCCTGATACTCCA
GACTGTGCTGGAGATAGTCATACCCCACTGGCTTTTTCCTTCACCGAGGACTTGGAAAGTTCTTGTTTG
CTAGACCGAAAGGAAGAAAAAGGGGATTCTGCCAGGAAATGGGAATGGCTTCATGAGTCTAAGAAGAAC
TATCAGAGTATGGAGAAACACACCAAACTACCTGGGGACAAATGCTGTCAGCCCTTAGGCAAGACTAAA
TTGGAAAGAAAGGTGTCTGCCAAAGAAAACAGGCAGGCCCCTGTCCTCCTTCAAACATACAGGGAATCC
TGGAATGGAGAAAACATAGAATCAGTGAAACAAAGCCGTAGTCCAGTTTCTGTGTTTTCCTGGGACAAT
GAAAAGAATGACAAGGACTCCTGGAGTCAACTTTTCACTGAAGATTCTCAAGGCCAGCGGGTCATTGCC
CACAACACTAGAGCTCCTTTTCAAGATGTAACCAATAACTGGAATTGGGACTTAGGGCCGTTTCCTAAC
AGTCCTTGGGCTCAGTGCCAGGAGGATGGGCCAACTCAAAATCTGAAGCCTGATTTGCTCTTTACCCAG
GACTCTGAAGGTAATCAAGTTATCAGACACCAATTCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_024037
Insert Size 1074 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024037.2
RefSeq Size 2178 bp
RefSeq ORF 1074 bp
Locus ID 79000
UniProt ID Q9H7T9
Cytogenetics 1p36.11
MW 40.3 kDa
Summary DNA-binding protein that accumulates at DNA double-strand breaks (DSBs) following DNA damage and promotes DNA resection and homologous recombination (PubMed:29042561). Serves as a sensor of DNA damage: binds DNA with a strong preference for DNA substrates that mimic structures generated at stalled replication forks, and anchors RBBP8/CtIP to DSB sites to promote DNA end resection and ensuing homologous recombination repair (PubMed:29042561). Inhibits non-homologous end joining (NHEJ) (PubMed:29042561). Required for the dynamic movement of AURKA at the centrosomes and spindle apparatus during the cell cycle (PubMed:20596670).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate 3' terminal exon, compared to variant 1. It encodes isoform 2 which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:C1orf135 (AUNIP) (NM_024037) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200831 AUNIP (Myc-DDK-tagged)-Human chromosome 1 open reading frame 135 (C1orf135) 10 ug
$457.00
RC200831L3 Lenti ORF clone of Human chromosome 1 open reading frame 135 (C1orf135), Myc-DDK-tagged 10 ug
$757.00
RC200831L4 Lenti ORF clone of Human chromosome 1 open reading frame 135 (C1orf135), mGFP tagged 10 ug
$757.00
RG200831 AUNIP (tGFP-tagged) - Human chromosome 1 open reading frame 135 (C1orf135) 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.