Ninjurin2 (NINJ2) (NM_016533) Human Untagged Clone

SKU
SC304430
NINJ2 (untagged)-Human ninjurin 2 (NINJ2)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Ninjurin2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC304430 representing NM_016533.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGGTCTGTCCCGCCAGCTGTGTGCTCTCTCCCACCCGAAGAAAGCAGCAGAGACTCAGACGGCG
GAGCCTGGAGGAGCCCACGCAGTCTGTTCCCGGCACCCGGTGCGTGTGAAGGGACTTGAGGGCAGCGAG
ATGGAATCAGCAAGAGAAAACATCGACCTTCAACCTGGAAGCTCCGACCCCAGGAGCCAGCCCATCAAC
CTGAACCATTACGCCACCAAGAAGAGCGTGGCGGAGAGCATGCTGGACGTGGCCCTGTTCATGTCCAAC
GCCATGCGGCTGAAGGCGGTGCTGGAGCAGGGACCATCCTCTCACTACTACACCACCCTGGTCACCCTC
ATCAGCCTCTCTCTGCTCCTGCAGGTGGTCATCGGTGTCCTGCTCGTGGTCATTGCACGGCTGAACCTG
AATGAGGTAGAAAAGCAGTGGCGACTCAACCAGCTCAACAACGCAGCCACCATCTTGGTCTTCTTCACT
GTGGTCATCAATGTTTTCATTACAGCCTTCGGGGCACATAAAACAGGGTTCCTGGCTGCCAGGGCCTCA
AGGAATCCTCTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_016533
Insert Size 567 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016533.5
RefSeq Size 1225 bp
RefSeq ORF 567 bp
Locus ID 4815
UniProt ID Q9NZG7
Cytogenetics 12p13.33
Protein Families Transmembrane
MW 20.4 kDa
Summary The protein encoded by this gene belongs to the ninjurin (for nerve injury induced) family. It is a cell surface adhesion protein that is upregulated in Schwann cells surrounding the distal segment of injured nerve, and promotes neurite outgrowth, thus may have a role in nerve regeneration after nerve injury. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (1) encodes the longest isoform (1). CCDS Note: The coding region has been updated to start at a downstream in-frame start codon that is supported by conservation data.
Write Your Own Review
You're reviewing:Ninjurin2 (NINJ2) (NM_016533) Human Untagged Clone
Your Rating
SKU Description Size Price
RC219393 NINJ2 (Myc-DDK-tagged)-Human ninjurin 2 (NINJ2) 10 ug
$300.00
RC219393L1 Lenti ORF clone of Human ninjurin 2 (NINJ2), Myc-DDK-tagged 10 ug
$600.00
RC219393L2 Lenti ORF clone of Human ninjurin 2 (NINJ2), mGFP tagged 10 ug
$600.00
RC219393L3 Lenti ORF clone of Human ninjurin 2 (NINJ2), Myc-DDK-tagged 10 ug
$600.00
RC219393L4 Lenti ORF clone of Human ninjurin 2 (NINJ2), mGFP tagged 10 ug
$600.00
RG219393 NINJ2 (tGFP-tagged) - Human ninjurin 2 (NINJ2) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.